Abstract
Interstitial leukocyte infiltration is a major finding in tubulointerstitial damage (TID). Infiltrating lymphocytes interact with proximal tubular epithelial cells (PTEC) by means of secreted soluble factors and/or cell contact mechanisms. CD40 expressed onto PTEC can be engaged by CD40L present on T cells. PTEC are able to locally secrete complement C3, which may most likely promote TID. The aim of the study was to investigate the putative action of CD40 ligation on enhancement of C3 secretion by PTEC. Primary human PTEC and stabilized HK-2 cells were used in culture experiments. Cells were stimulated by soluble factors IL-1β, IFN-γ, and/or CD40L-expressing murine fibroblast L cells. Analysis of C3 gene expression was evaluated by reverse-transcription PCR and Northern blot. Secreted C3 was assayed by ELISA and a functional hemolytic test on supernatants. Intracellular events were explored by the NF-κB–specific inhibitor caffeic acid phenetyl ester (CAPE). Among soluble factors, IL-1β and IFN-γ increased C3 gene expression and secretion (two-fold to three-fold versus basal) on both HK-2 and PTEC. CD40 engagement by CD40L upregulated HK-2 C3 secretion by four-fold. IL-1β did not further increase CD40-induced C3 secretion, whereas IFN-γ associated with CD40L was the strongest stimulus (30-fold increase). Inhibition of NF-κB offset CD40L-induced C3 secretion by 70%. CD40 ligation is able to enhance C3 secretion by PTEC. This cell contact mechanism is in synergism with a T cell–derived soluble factor (IFN-γ). C3 secretion induced by CD40L may represent a mechanism of amplification of TID associated with lymphocyte infiltration.
Renal tubulointerstitial damage (TID) is characterized by interstitial leukocyte infiltration and fibrosis and is often associated with progressive chronic glomerulonephritides that determine loss of renal function (1). Putative pathogenic factors that underline a causative relationship between the primary glomerular injury and the consequent TID are mostly unknown. Leukocyte infiltration of the interstitial compartment is both a morphologic finding and a basic pathogenic event of TID, especially at the interface with cortical tubular cells. Proximal tubular epithelial cells (PTEC) can be stimulated by protein overload (2), for example under massive proteinuric glomeronephritides, to release chemotactic factors for lymphocytes, monocytes, and neutrophils (3–6) and complement (7,8). However, activated tubular cells are able to release, in response to T cell–derived cytokines, chemokines such as RANTES, monocyte chemoattractant protein (MCP)-1 (9,10), and IP-10 (11), which, in turn, amplify the interstitial T cell and monocyte infiltration.
Among different cell-to-cell contact mechanisms, CD40-CD40L (CD154) interaction seems to play a relevant role in transplant rejection and inflammatory renal diseases. CD40 is a co-stimulatory molecule expressed by PTEC in culture (10,12–14). In normal human kidneys CD40 is found in glomeruli and distal tubules but not in proximal tubules. However, in different nephropathies with relevant TID such as proliferative lupus nephritis, severe IgA nephropathy, and necrotizing vasculitis, CD40 is strongly expressed by PTEC and associates with interstitial CD40L-positive cells (15). CD40 ligand (CD40L or CD154) is mainly found on activated CD4+ T cells. CD40L triggers CD40 expressed by PTEC and induces the release of pro-inflammatory molecules such as IL-6, MCP-1, and IL-8 (9,16). This latter phenomenon plays a pathogenic role in renal interstitial T cell recruitment and TID.
Among several soluble PTEC-derived pro-inflammatory mediators, C3 is a central complement factor that generates activated fragments, which are able to increase vascular permeability (C3a) and promote inflammatory cell interaction (C3b). Therefore, the local production of C3, mainly by PTEC (17), is a relevant pathogenic event associated with TID in several immunologically mediated chronic nephropathies.
In this study, we hypothesized that once the interstitial infiltration has been established, PTEC–T lymphocyte interaction through CD40–CD40L cross-linking may contribute to a further increase of PTEC C3 synthesis by means of a cell-to-cell contact mechanism that parallels the possible cytokine-induced C3 upregulation.
We showed that CD40 ligation of PTEC is able to induce C3 release comparable to soluble factors such as IL-1β and IFN-γ. Moreover, cell-to-cell contact mechanisms (CD40L/CD40 interaction) in concert with soluble factors (IFN-γ) synergistically stimulate PTEC to secrete C3.
Materials and Methods
PTEC Cultures
Two different types of PTEC lines were used for cell culture experiments: HK-2 cells (ATCC, Bethesda, MD) and primary nontransformed human PTEC.
Human PTEC were isolated from renal cortex of anatomically normal portions of kidneys removed surgically for renal cell carcinoma. Renal cortex fragments were cut into 1- to 2-mm3 pieces and sequentially filtered through sieves of 425 and 180 μm. After digestion with collagenase dispase (1mg/ml) at 37°C for 5 min, tubular cells were resuspended in DMEM F12, 10% FCS, and incubated in 75-cm2 flasks at 37°C, 5% CO2. After 6 d, PTEC were washed with DMEM F12 to eliminate cellular debris and nonadherent cells, resuspended in DMEM F12, 10% FCS, and incubated at 37°C, 5% CO2. All experiments performed on PTEC used cells at the 3 to 6 passage. Both HK-2 and PTEC were cultured in complete DMEM F12 medium (Life Technologies BRL/Life Technologies, San Giuliano Milanese, Italy) supplemented with all of the following components: l-glutamine 1%, penicillin-streptomycin 1%, insulin 5 μg/ml, transferrin 5 μg/ml, sodium selenite 5 ng/ml, hydrocortisone 5 ng/ml, prostaglandin E1 1 pg/ml, EGF (Sigma-Aldrich, Milan, Italy) 10 ng/ml, and fetal bovine serum 2%.
Cell Culture Experiments
Cells were seeded in Petri dishes (10-cm diameter) for Northern blot assays. Experiments finalized at evaluating C3 level by ELISA with both PTEC and HK-2 cells were set up in three separate wells for each condition in 6-well plates. Cells were kept in a resting state for 24 h, in serum-free medium. IL-1β (100 U/ml) (obtained through the courtesy of National Cancer Institute, Biologic Response Modifiers Program, Frederick, MD) and IFN-γ (500 U/ml) (Life Technologies) were used as soluble stimuli.
CD40 ligation was performed by means of cell-to-cell contact with cell-bound CD40L. For this purpose, a mouse fibroblast cell line (L cells) transfected with the full-length CD40L coding sequence and expressing the protein on the cell surface was used (kindly provided by Dr. M. Shurin, University of Pittsburgh Cancer Institute, Pittsburgh, PA). Parent untransfected L cells were used as controls.
Coculture experiments with a 1:1 PTEC or HK-2 ratio to L cells were set-up. To block cell proliferation, L cells were irradiated with 10,000 rad before addition to renal cell cultures.
Finally, the role of activation of NF-κB was assessed by means of a specific inhibitor: caffeic acid phenetyl ester (CAPE) (Calbiochem, San Diego, CA) (18). CAPE was dissolved in DMSO at final concentration of 5 μg/ml; the volume of DMSO did not exceed 5% of the culture medium, and DMSO was also added to the basal condition wells. Incubation time was 48 h.
Isolation of Total RNA
To assess C3 gene expression, total RNA was purified from PTEC and HK-2 cell pellets by the Trizol method (Life Technologies) according to manufacturer instructions. RNA pellets were resuspended in distilled water.
Analysis of C3 Gene Expression
C3 transcript was analyzed by reverse-transcription (RT)-PCR or Northern blot. For RT-PCR, 1 μg of total RNA was reverse-transcribed into cDNA with 100 U of molony murine leukemia virus (MMLV) reverse-transcriptase (Applied Biosystems, Branchburg, NJ) and oligo-dT as universal primer according to a previously described protocol (19). PCR with C3-specific primers was performed as described (19). One unit of Taq polymerase (Applied Biosystems, Branchburg, NJ) was added to each reaction tube. C3-specific primers were upstream, CTTGATGGTCTGCTCAATGGC; and downstream, GAGATCTGTACCAGGTACC. The amplified fragment was a 554-bp-long product. Primers for the housekeeping GAPDH gene were upstream, ATTCGTTGTCATACCAGGA; downstream, TGGTATCGTGGAAGGACTCATGAC; and defined a 450-bp fragment.
For Northern blot analysis, 20 μg of total RNA from each sample were run in 2.2 M formaldehyde denaturing 1.1% agarose gel. RNA was then blotted onto a nylon membrane (Schleicher & Schuell, Dassel, Germany) and cross-linked by heating in vacuum oven at 80°C for 1 to 2 h. Hybridization with the specific C3 probe was performed as described (19). The human C3 probe, radiolabeled with 32P by means of the Readyprime kit (Amersham, Little Chalfont, UK), was a 1.8-kb fragment obtained by Cla I and Sa lI sequential digestion of the full-length C3 clone pHLC3.11 purchased from ATCC. After stripping, nylon membranes were also rehybridized with a GAPDH-specific probe as a housekeeping gene.
Hybridized membranes were exposed to X-omat films (Kodak, Rochester, NY). Specific band densities were quantified by an image analysis system and a specific software (OptiLab Pro 2.6.1; Graftek, Villanterio, PV, Italy).
Evaluation of C3 Secreted Protein on Culture Supernatants by ELISA
To assess the concentration of C3 in cell culture supernatants, an ELISA was set up as described (20). Briefly, 96-well polystyrene plates were coated with polyclonal rabbit anti-human C3 (Dako, Milano, Italy) diluted 1:500 in carbonate buffer (0.1 M pH 9.6) and incubated for 2 h at 37°C. After blocking with BSA 2%, each diluted supernatant was added either in triplicate or in quadruplicate wells (100 μl/well) and incubated at 10°C for 2 h. Plates were washed and incubated with horseradish peroxidase-conjugated rabbit anti-human C3c (1:2000 dilution; Dako). The linked enzyme was then developed with ophenylenediamine (OPD) and incubated at room temperature for 10 min. OD reading was performed at 490 nm. A standard curve was generated with proper dilutions of a human serum protein standard (Dade Behring, Marburg, Germany). Assay sensitivity was of 2 ng/ml. Concentrations of C3 in supernatants were normalized versus cellular proteins and expressed as ng C3/μg cellular proteins. Cellular proteins were assessed by a Bradford assay (21). Absorbance reading was performed at 595 nm.
Flow Cytometry for CD40 on HK-2 Cells
CD40 expression by HK-2 cells was evaluated by flow cytometric analysis. At the end of the stimulation period, cells were removed by trypsin (Sigma-Aldrich), then centrifuged and washed with Hank’s buffer containing 0.1% BSA and 0.02% sodium azide (FACS buffer). Cells (5 × 105) were incubated with a FITC-conjugated monoclonal mouse anti-human CD40 (BioD, Bari, Italy) for 30 min at 4°C in the dark, the amount of antibody used was 5 μl for each sample diluted in FACS buffer without BSA. HK-2 cells were then washed twice with ice-cold FACS buffer without BSA and analyzed by a particle analyzing system flow cytometer (Partec, Münster, Germany). Background fluorescence was estimated with a nonrelevant mouse monoclonal antibody of the same isotype.
Hemolytic Assay for Functional C3
To evaluate whether the secreted C3 was functionally active, a hemolytic assay was set-up; 1-ml aliquots of culture supernatants or unconditioned medium were concentrated to a final volume of 100 μl by centrifugation through a Centricon YM-10 (Millipore, Bedford, MA) filter with a molecular weight cutoff of 12,000 daltons and stored at −70°C until assayed. For the assay, 1.5 ml of a sensitized sheep erythrocytes suspension (EZ complement; Diamedix, Miami, FL) was used for each specimen; 3 μl of C3-depleted normal human serum (Calbiochem, San Diego, CA) and the concentrated supernatants were added to each tube. Blank sample was run by adding 3 μl of C3-depleted human serum and 100 μl of concentrated unconditioned culture medium. A reference serum with titrated CH50 activity (EZ complement reference serum; Diamedix) was used as standard. All tubes were incubated for 1 h at room temperature, then centrifuged at 600 × g for 10 min. Hemolysis was evaluated by reading OD of supernatants at 415 nm. For each culture supernatant, the number of C3 hemolytic units was calculated by the following formula: 
Statistical Analyses
Comparison of mean values was performed by unpaired t test. C3 concentrations of the kinetic assay were plotted against time and correlation was calculated by linear regression analysis. To assess the C3 secretion rate per unit of time, the slope of the curve was calculated and data were expressed as X coefficient ± standard error.
Results
Induction of C3 Gene Expression and Protein Secretion by Soluble Cytokines on HK-2 Cells
We first examined the specific response of HK-2 cells to soluble cytokines. HK-2 cells cultured for 72 h in presence of IL-1β or IFN-γ showed an upregulation of the C3 gene transcript compared with basal conditions, as evidenced by RT-PCR analysis of total RNA (Figure 1A). Supernatants of such cultures assayed for C3 concentrations demonstrated that IL-1β provoked a two-fold increase of C3 secretion (P = 0.024), whereas IFN-γ operates a three-fold C3 induction with respect to the basal conditions (P = 0.008) (Figure 1B).
(A) Analysis of RNA isolated from HK-2 cells stimulated for 72 hours with soluble cytokines: IL-1β (100 U/ml), IFN-γ (500 U/ml). RNAs were first reverse-transcribed and then amplified with oligonucleotide pairs specific for C3 or the housekeeping gene GAPDH. (B) C3 concentrations assayed by ELISA on supernatants of HK-2 stimulated by soluble cytokines. C3 concentrations were normalized with the amount of proteins present in cellular pellets (see Materials and Methods). Stimulation experiments were performed in triplicate wells for each individual condition. Data represents mean ± SD (n=3). Statistical analysis: *P < 0.03 versus basal.
Effects of CD40 Ligation on C3 Production by HK-2 Cells
To evaluate the effects of cell-to-cell contact mechanisms, represented by CD40 cross-linking, on C3 gene expression and synthesis, HK-2 cells were cocultured for 72 h with CD40L-expressing L cells. As control, HK-2 cells were also cocultured with nontransfected L cells.
RT-PCR analysis showed an increased C3 gene transcription in HK-2 cells cultured with CD40L-expressing L cells (Figure 2A) compared with control conditions. Conditioned culture media assayed for C3 by ELISA demonstrated that CD40 cross-linking was a potent stimulus inducing a 12-fold C3 production compared with coculture with untransfected L cells (Figure 2B).
(A) Reverse transcription (RT)-PCR analysis of RNA isolated from HK-2 cells stimulated for 72 hours with either untransfected L-cells (control) or CD40L-expressing L-cells. cDNAs were amplified with oligonucleotide pairs specific for C3 or the housekeeping gene GAPDH. Amplified products were separated on agarose gel and stained with ethidium bromide. (B) C3 concentrations assayed by ELISA on supernatants of HK-2 stimulated by CD40 ligation or untransfected L-cells (control). C3 concentrations were normalized with cellular proteins. Stimulation experiments were performed in triplicate wells for each condition. Statistical analysis: *P < 0.03 versus basal (L-cell).
Evaluation of Functional Activity of Secreted C3 by Hemolytic Assay
To test whether the C3 secreted by HK-2 cells was hemolytically active, we used a hemolytic assay with sensitized sheep erythrocytes and C3-depleted human serum as a source of all but C3 complement components. Functional C3 was detected in HK-2 cell culture supernatants. Hemolytic activity of C3 was higher in IL-1β, IFN-γ, and CD40L conditioned media versus basal (Figure 3), showing that CD40 ligation induced a C3 capable of sustaining complement activation.
Evaluation of C3 levels in conditioned supernatants of HK-2 cells by a functional hemolytic assay. Concentrated conditioned supernatants were incubated with a sensitized sheep red blood cell suspension in presence of C3-depleted human serum, as source of all other complement components. After incubation for 1 hour and centrifugation, degree of red blood cell hemolysis was estimated by OD at 415 nm. Conversion of OD readings in hemolytic units was performed by comparing data with a standard human serum with a titrated hemolytic activity. Data represent mean value of duplicate wells.
Effects of CD40L and Soluble Factors on C3 Production by HK-2 Cells
It has been shown that CD40L acts synergistically with soluble factors inducing cytokine and chemokine production by renal epithelial cells (10). Therefore, we tested the association of known C3 stimulating factors and CD40L on HK-2 cells.
We found that the association of IL-1β with CD40 ligation determined a partial reduction of the stimulating effect of CD40 cross-linking on C3 synthesis. This effect was, however, not statistically significant compared with CD40L alone (Figure 4A). Conversely, a dramatic increase of C3 secretion was obtained by a combination of CD40 engagement and IFN-γ stimulation (P = 0.001 versus basal). Both factors were synergic as demonstrated by an increase of C3 production up to 9.48 ± 1.87 ng/μg (P = 0.02 and P = 0.001 versus CD40L and IFN-γ stimulation, respectively) (Figure 4A).
(A) C3 concentrations assayed by ELISA on supernatants of HK-2 stimulated by CD40 ligation alone or in association with soluble cytokines. Incubation time was 48 hours. C3 concentrations normalized with cellular proteins. Data represent mean ± SD of triplicate wells. Statistical analysis: *P < 0.03; **P < 0.004 versus basal (L-cell). (B) Kinetic analysis of C3 synthesis and release by HK-2 under IFN-γ and/or CD40L stimulation. HK-2 cells were incubated with IFN-γ (500 U/ml) or co-incubated with CD40L-expressing L-cells in a 1:1 cell ratio. Also, IFN-γ was added to HK-2 cells coincubated with CD40L-positive L-cells. Incubation was stopped progressively at 4, 8, 12 and 24 hours. Supernatants were then assayed for C3 by ELISA. Data represent mean ± SD of triplicate wells. In order to calculate the variation of C3 secretion per unit of time regression analysis was performed.
To study the kinetic profile of C3 secretion under maximal cytokine stimulation and CD40 ligation, HK-2 cells were coincubated with CD40L-expressing L cells or stimulated with IFN-γ or a combination of both. Incubation was progressively terminated after 4, 8, 12, and 24 h. As shown in Figure 4B, from the slope of each curve it was possible to estimate a C3 secretion rate increasing from 0.88 ± 0.06 ng/ml per h under basal condition to 2.40 ± 0.20, 2.82 ± 0.25, and 4.89 ± 0.34 ng/ml per h under IFN-γ, CD40L, or CD40L+IFN-γ stimulation, respectively (Figure 4B).
Effects of CD40L and Soluble Factors on C3 Gene Expression and Production by PTEC
To evaluate the effects of CD40 ligation on primary PTEC, we performed coculture experiments with three different PTEC lines. C3 gene induction was quantified by Northern blot. As shown in Figure 5, A and B (one representative PTEC line), CD40 cross-linking determined a 4.5-fold upregulation of C3 gene transcription compared with basal, whereas C3 mRNA abundance raised by 2.3-fold under IL-1β stimulation. The association of CD40L and IL-1β stimulation induced an increased C3 transcription to a lesser extent as compared with CD40L alone. IFN-γ increased C3 gene transcription by 2.6-fold, but most importantly and similarly to HK-2 cells, the association of CD40L and IFN-γ was able to induce maximal C3 mRNA upregulation (Figure 5B).
Northern blot analysis of RNA extracted from proximal tubular epithelial cells (PTEC) cultured for 72 hours under different conditions. The blotted membrane was firstly hybridized with a human C3 specific cDNA probe (panel A, right hand side lanes); then, after stripping was rehybridized with a GAPDH-specific cDNA probe (panel A, left hand side lanes). Intensity of bands was analyzed by a specific software (see Materials and Methods) and results expressed by arbitrary units normalized versus intensity of GAPDH (panel B).
Moreover, the amount of C3 produced by primary PTEC was evaluated on conditioned supernatants. In Table 1, mean concentrations of C3 in supernatants are reported. Overall, the pattern of C3 secretion resembled the one observed with HK-2 cells. Basal levels in these nontransformed cells were higher, compared with HK-2 cells. IL-1β and IFN-γ increased C3 synthesis by approximately 2.4-fold. Again, the most effective stimulant was represented by CD40 ligation on PTEC surface and the maximal response was induced by the cooperative action of CD40L and IFN-γ (increase of C3 release versus basal of 2.3- to 3.5-fold, respectively) (Table 1).
Modulation of C3 secretion by different soluble stimuli and CD40 ligation on one PTEC line
Role of NF-κB in Mediating Induction of C3 Production
To evaluate the putative intracellular transduction mechanisms involved in C3 upregulation, culture experiments were performed with a specific NF-κB inhibitor CAPE. As shown in Figure 6, CAPE dramatically reduced C3 concentration in supernatants of HK-2 cells cultured under basal conditions, or in the presence of CD40L alone or CD40L plus IFN-γ. Interestingly, CD40L-mediated induction of C3 production was inhibited by approximately 73%. Therefore, C3 synthesis induced by CD40 ligation on PTEC seems to be mediated by NF-κB activation even in the presence of IFN-γ.
C3 secretion by HK-2 cells cultured for 48 hours under stimulation with IL-1β, CD40L, or CD40L + IFN-γ either with or without the specific NF-κB inhibitor caffeic acid phenetyl ester (CAPE), 5 mg/ml. C3 concentrations evaluated by ELISA were normalized with cellular proteins. Data represent mean value ± SD of C3 concentrations in three individual wells for each condition. Statistical analysis: *P < 0.01; **P < 0.02 versus paired stimulus without CAPE.
Modulation of CD40 Expression by CD40L and IFN-γ
To assess the influence of IFN-γ and/or CD40L stimulation on the CD40 expression, HK-2 cells were incubated with the specific condition for 48 h; therefore, level of CD40 expression was analyzed by flow cytometry. As shown in Figure 7, CD40 ligation induced a slight increase of CD40 expression, whereas the molecule was significantly upregulated on HK-2 by IFN-γ alone in association with CD40L stimulation.
Flow cytometric analysis of CD40 expressed on HK-2 cells stimulated with IFN-γ (B), CD40L (C) or CD40L + IFN-γ (D). Shaded diagrams represent CD40 expression by HK-2 cells under resting condition. Diagram A represents fluorescence with a non-relevant isotypic control monoclonal antibody.
Discussion
In this work, we show evidence that C3 might be produced locally in renal tissue at an increased rate by means of a lymphocyte contact with PTEC in conditions in which interstitial inflammation predominates.
Production of C3 and other complement components by renal cells has been consistently reported in vitro, in vivo, and ex vivo human studies (22). C3 is produced by PTEC in basal conditions and at an increased rate under stimulation with potent pro-inflammatory factors. Because all published data on complement production by PTEC have dealt with untransformed primary cells, we first assessed the specific responsiveness of the papillomavirus-transformed HK-2 cells.
We found that IL-1β, as previously demonstrated (23), upregulated C3 mRNA abundance and significantly increased C3 production by HK-2 cells. The most relevant finding of the present work, however, is the demonstration for the first time to our knowledge that immune mechanisms mediated through cell contact involving PTEC and lymphocytes are endowed with C3 stimulating capability. CD40 expression in cell culture systems has been demonstrated in both primary PTEC (24) and transformed HK-2 cells (12). The effect of CD40L-induced C3 gene upregulation and protein secretion was more pronounced compared with IL-1β.
CD40L acted on both HK-2 cells and primary PTEC. Combination of the two stimulants resulted neither in a synergistic nor in an additive effect. Instead, a certain reduction of C3 production compared with CD40 ligation was observed, although it was not statistically significant. However, IFN-γ also increased C3 production and, when associated with CD40L, it exerted a synergistic effect at gene expression and protein release level. The combined action of IFN-γ and CD40 ligation operates through CD40 upregulation on HK-2 as demonstrated by flow cytometric analysis. Therefore, a combined effect of cell contact interaction and a soluble factor such as IFN-γ, which is released by activated T cells, has a great pathogenic relevance in PTEC activation and C3 secretion. Pertinent to this discussion is the finding that CD40L is additive or synergistic with IFN-γ in stimulating synthesis of other pro-inflammatory mediators such as RANTES and IL-15 by PTEC (13,14).
Moreover, we found that C3 produced by HK-2 cells was functionally active, as demonstrated by a hemolytic assay. Only an approximate correlation between functional activity of C3 and concentration of protein in supernatants was present, probably caused by the spontaneous inactivation of C3, which might have occurred over the 48-h culture period.
Intracellular transduction mechanisms activated by CD40–CD40L interaction involve both mitogen-activated kinase and NF-κB (25,26). NF-κB activation especially occurs in embryonic kidney cells (27). Our data are coherent with such observations because C3 induction by CD40L seems to be mediated through NF-κB generation. In coculture experiments performed in presence of a specific NF-κB inhibitor (CAPE), C3 induction by CD40L decreased by 70%. Our observation is in keeping with the described prominent role of NF-κB in mediating overexpression of pro-inflammatory and fibrogenic factors by tubular cells in human progressive renal diseases (28).
The pathogenic involvement of CD40L–CD40 interaction in renal pathology has been established mainly in two different conditions. First, in lupus and other inflammatory nephritides with prominent TID, high levels of CD40 expression are shown in proximal and distal tubules and glomeruli (15,29). However, the development of nephritis can be experimentally ameliorated by administration of an anti-CD40 monoclonal antibody in animal models of SLE (30,31) and by anti-CD40L in human SLE (32). Second, rejection of allogenic kidney transplant seems to be at least in part mediated through CD40L–CD40 interaction in renal tissue, because pretreatment with anti-CD40L antibody prevents organ rejection (33–35). With the work, we can hypothesize that downstream mechanisms able to mediate the pathogenic role of CD40L in different renal diseases may encompass induction of C3 secretion by PTEC. In fact, recent experimental evidence suggests a relevant role for the locally produced C3 in mediating acute rejection and allograft survival in a mouse kidney transplantation model (36). C3 produced and activated locally engaged CR1/CR2 receptor on a subpopulation of activated Th1 cells, determining a modulation of the antigen presenting cell function of PTEC.
Apart from its role in allograft rejection, tubular production or deposition of C3 is involved in TID associated with IgA or membranous nephropathy (37,38). Ample experimental data support this statement: C3 gene expression and protein secretion in tubular cells and periglomerular interstitial cells precede development of TID in a mouse model of immune complex–mediated glomerulonephritis (39).
In summary, C3 secretion by PTEC may promote TID and represents a common denominator of such diverse diseases and, perhaps, it has the potential to catalyze progression of renal damage to renal failure. Therefore, attempts to clarify all of the individual pathogenic factors aimed at future therapeutic interventions are warranted. With this study, we can hypothesize that besides soluble factors that trigger PTEC from both apical lumen (proteins and terminal complement complex (7,38) in proteinuric states) and basolateral site (lymphocyte and monocyte-derived soluble cytokines), cell-contact–immune mechanisms mediated through CD40 ligation on PTEC may represent a prominent modality for the development and progression of TID in several types of chronic nephropathies.
Acknowledgments
This work was supported by the CNR target project on Biotechnology “Comitato Eccellenza Genomica in Campo Biomedico ed Agrario” and a grant to “Giovani Ricercatori” awarded by the MIUR to V.C. We thank Dr. Elena Ranieri for the critical review of the manuscript and helpful suggestions. We are also indebted to Mariella Mastrolonardo for editorial assistance of the manuscript. The help of Dr. Lea Roca in performing flow cytometric analysis is greatly appreciated.
Footnotes
Published online ahead of print. Publication date available at www.jasn.org.
- © 2005 American Society of Nephrology
References
