Pathophysiology of Renal Disease and Progression

NF-κB Regulates Fas-Mediated Apoptosis in HIV-Associated Nephropathy

Michael J. Ross, Scott Martinka, Vivette D. D’Agati and Leslie A. Bruggeman
JASN August 2005, 16 (8) 2403-2411; DOI: https://doi.org/10.1681/ASN.2004121101

Abstract

Renal parenchymal injury in HIV-associated nephropathy (HIVAN) is characterized by epithelial proliferation, dedifferentiation, and apoptosis along the entire length of the nephron. Although apoptotic cell death in HIVAN has been well documented, the mechanism for HIV-induced apoptosis is poorly understood. Whether the epithelial apoptosis in HIVAN is mediated by NF-κB–activated Fas ligand expression was investigated here. In human HIVAN and HIV-1 transgenic mouse kidney specimens, the expression of Fas receptor and ligand proteins were markedly upregulated on epithelium in diseased glomerular and tubulointerstitial compartments when compared with normal. Podocyte cell lines that were derived from HIV-1 transgenic mice showed a similar upregulation of Fas receptor expression and de novo expression of Fas ligand by semiquantitative reverse transcription–PCR and Western blotting. In cultured podocytes, cross-linking of the Fas receptor to mimic ligand binding induced caspase 8 activity and apoptosis in both normal and HIVAN podocytes. Because constitutive NF-κB activity has been demonstrated in HIVAN epithelia, evidence for transcriptional control of the Fas ligand expression by NF-κB was sought. With the use of cultured podocytes, expression of a Fas ligand promoter reporter plasmid was higher in HIVAN podocytes, indicating increased transcriptional activity. In addition, chromatin immunoprecipitation assays were performed to demonstrate that p65-containing (RelA) complexes bound the Fas ligand promoter and that suppression of activated NF-κB with a peptide inhibitor could reduce the expression of Fas ligand mRNA in HIVAN podocytes. These results suggest that NF-κB may regulate Fas-mediated apoptosis in HIVAN by controlling the expression of Fas ligand in renal epithelium.

In the United States, HIV-associated nephropathy (HIVAN) affects approximately 1% of the overall HIV-1–seropositive population and has become the third most common cause of renal failure in adult black men (1,2). A component of the disease process is the direct infection of renal parenchymal cells, including all tubular, parietal, and visceral epithelial cell types (3). The pathology of HIVAN thus is largely typified by epithelial cell defects and includes both a glomerular lesion (collapsing focal segmental glomerulosclerosis [FSGS]) and an equally profound tubulointerstitial lesion that involves all segments of the nephron (4,5). Previous investigations characterizing these epithelial cell defects have shown that the cells undergo a dedifferentiation that includes changes in the expression level and pattern of cell differentiation markers and increased rates of proliferation (6,7). There also is a well-described increase in apoptotic cell death, which has been documented in human kidney biopsies, in kidneys from animal models of HIVAN, and with in vitro infections of cultured renal epithelial cells (6–12).

In general, a pathologic role for apoptotic cell death has been described in many forms of chronic and acute renal diseases and in transplant rejection. The most common mechanism of apoptosis implicated in the kidney is mediated by Fas (CD95) and Fas ligand (FasL; CD178) interactions. Many renal cell types normally express Fas and FasL, and renal expression of these proteins can be upregulated in response to various disease processes (13). In HIVAN, a previous report by Conaldi et al. (9) presented evidence for Fas upregulation during HIV-1 infection of cultured proximal tubular epithelial cells and suggested a role for Fas-mediated apoptosis in the tubular damage of HIVAN.

It was shown previously that the transcription of the genes for Fas (14–16) and FasL (17–19) are regulated by NF-κB, an inducible transcription factor complex with a principal role in mediating immune and inflammatory processes (20). NF-κB also has a central role in regulating apoptosis. Initially, NF-κB was believed to be exclusively an antiapoptotic factor primarily on the basis of the analysis of several NF-κB null (knockout) transgenic mice. This is clearly the case in the development and homeostasis of the immune system; however, this is not a universal observation for all cell types or signaling events. It has become increasingly more evident that NF-κB can have both antiapoptotic and proapoptotic functions, depending on the stimulus, cell type, and differentiation state (21). The proapoptotic functions of NF-κB are associated with its ability to increase the expression of well-known proapoptotic genes, such as Fas and FasL, and also possibly through mechanisms that repress antiapoptotic gene expression (22).

In HIV-1–infected immune cells, NF-κB is a necessary host transcription factor that is required for both elongation of initial, Tat-independent viral transcripts and producing the high levels of Tat-dependent viral gene expression needed for productive infection (23). It also has been shown in chronically infected immune cells that NF-κB is altered to a “persistently activated” state, thus ensuring the abundant expression of the viral genes (24). Similar to infected immune cells, we showed previously that HIV-1 gene expression in the kidney is also dependent on NF-κB transactivation (25), and we have new evidence that suggests that NF-κB is similarly dysregulated to a persistently activated state in HIV-1–expressing kidney cells (Bruggeman, unpublished observations).

Here we present evidence that links the altered NF-κB transactivation with renal epithelial cell apoptosis, a component of the pathogenic process in HIVAN. Using the HIV-1 transgenic mouse model and human biopsy specimens, we found that the expression of Fas and FasL was elevated in diseased kidneys in both glomerular and tubular cells. Because FasL expression is a crucial step leading to activation of the Fas pathway, we investigated the mechanism of FasL upregulation in HIV-1–expressing renal epithelial cells. Using conditionally immortalized podocyte cell lines from the HIV-1 transgenic mouse model, we observed elevated levels of Fas and FasL mRNA and protein in podocytes. This enhanced level of FasL mRNA in HIVAN podocytes could be reduced with treatment of an NF-κB inhibitor, and we further demonstrated the role of NF-κB by showing its direct binding to the FasL promoter in vivo, as well as elevated FasL promoter activity in HIVAN podocytes. These data suggest that the HIV-induced activation of NF-κB is associated with de novo FasL expression and subsequent podocyte apoptosis and thus may contribute to the glomerular lesion in HIVAN.

Materials and Methods

Mouse Model, Cell Lines, and Plasmids

The HIV-1 transgenic mouse model develops a renal disease very similar to human HIVAN and has been described in detail (26,27). The podocyte cell lines that are derived from this mouse model also have been described previously and include both transgenic podocytes isolated from a heterozygous adult mouse (“HIVAN podocytes”) and normal podocytes prepared from a normal littermate (28). The cell lines, conditionally immortalized with a temperature-sensitive SV40 T antigen, were propagated under permissive conditions and used for experiments after growth for 8 to 10 d at nonpermissive conditions as described previously (29). The soluble peptide inhibitor for NF-κB SN50 and control peptide SN50M were purchased from BIOMOL (Plymouth Meeting, PA) and used at 0.1 mg/ml. SN50 inhibits all p50-containing NF-κB and can have broad effects on NF-κB activation because multiple NF-κBs contain p50.

A FasL promoter reporter plasmid (pFasLTAL–secreted alkaline phosphatase [pFasLTAL-SEAP]) was constructed from pTAL-SEAP (Clontech, Palo Alto, CA) by inserting the previously characterized 750-bp murine FasL promoter region (17) into the KpnI/BglII cloning sites. An IκBα dominant negative expression plasmid, pCMV-IκBαM, was purchased from Clontech. As previously reported by the Pollak laboratory (30), cultured podocytes were transiently transfected using FuGENE 6 (Roche, Indianapolis, IN) at a 3:1 lipid to DNA ratio in 24-well dishes (2.5 × 104 cells/well). Because of the known differences in growth rates of the HIVAN and normal podocytes, all transfected cells were counted at the time of assay and data were normalized to cell number. The SEAP reporter is detectable in conditioned media and was assayed 48 h after transfection using a chemiluminescence kit (Great EscAPe; Clontech). Luminescence was measured with a luminometer, and data are reported in relative light units per 105 cells.

Immunohistochemistry and Western Blotting

Immunohistochemistry of human and mouse kidney sections was performed as described previously (5). Fas (M-20) and FasL (N-20) antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) were used at 1:200 dilution and detected with an avidin-biotin–based system (Vectastain ABC elite kit; Vector Laboratories, Burlingame, CA) with horseradish peroxidase–driven chromagen production (AEC substrate; Vector Laboratories). HIV-1 transgenic mouse kidneys and human tissue were formalin-fixed and embedded in paraffin. Human biopsies and normal human nephrectomy tissue were obtained in accordance with all requirements of the Mount Sinai Medical Center and Columbia University Medical Center Institutional Review Boards. All animal studies were conducted in accordance with the animal care and use requirements of Case Western Reserve University.

Western blotting was performed on whole-cell extracts using the protocol provided by the primary antibody manufacturer using the above Fas and FasL antibodies (1:1000 dilution). Secondary antibodies (1:1000 dilution) were horseradish peroxidase–conjugated goat anti-rabbit (Jackson ImmunoResearch, West Grove, PA), and detection was by luminescence (ECL; Amersham Biosciences, Piscataway, NJ) according to the manufacturer’s instructions.

Apoptosis Assays

Apoptosis detection in cell cultures was determined with a colorimetric assay for caspase-8 activity (ApoAlert; Clontech) used according to the manufacturer’s instructions with 106 cells. Apoptotic cells also were quantified using a fluorescence nuclear dye method as described previously (31). Data are presented as percentage of DAPI-enhanced late apoptotic nuclei per total nuclei in randomly selected high-power fields. Fas apoptosis was induced using a cross-linking anti-Fas antibody (Jo2; Pharmingen, San Diego, CA) at 5 μg/ml for 4 h. An anti-FasL antibody (Pharmingen) was used at 10 μg/ml for a 16-h pretreatment.

Reverse Transcription–PCR and Quantitative PCR

For reverse transcription, RNA from podocyte cell lines was extracted using TRIzol (Invitrogen, Carlsbad, CA), and 1 μg of total cellular RNA was used for synthesis of cDNA (SuperScript II; Invitrogen) using random priming. For standard PCR, amplification conditions and primers for murine Fas and FasL coding regions were as described previously (32). For semiquantitative PCR using standard PCR amplification conditions, a range of dilutions of input cDNA template were amplified for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to determine the amount of cDNA needed to visualize linear amplification of products resolved on agarose gels. This linear range of input cDNA (equivalent for GAPDH amplification between samples) subsequently was used for amplification of Fas and FasL. Primer pairs that were used for semiquantitative PCR for NF-κB target genes were as follows: Mouse IL-6 forward TAGTCCTTCCTACCCCAATTTCC and reverse TTGGTCCTTAGCCACTCCTTC, and mouse NF-κB p50 forward GGAGGCATGTTCGGTAGTGG and reverse CCCTGCGTTGGATTTCGTG. For quantitative (real-time) PCR (LightCycler FastStart DNA Master SYBR Green I; Roche), relative quantification with external standards (GAPDH) and analysis with the second derivative maximum method were used. Data are presented as the absolute number of mRNA copies. Quantitative PCR primers for murine FasL were forward CATCACAACCACTCCCACTG and reverse GTTCTGCCAGTTCCTTCTGC (GenBank accession no. S76752). Quantitative PCR amplification conditions were as follows: for FasL, melt at 96°C for 10 s, anneal at 68°C for 5 s, extend at 72°C for 10 s; and for GAPDH (primers purchased from Clontech), melt at 96°C for 10 s, anneal at 60°C for 5 s, and extend at 72°C for 10 s, all for 45 cycles.

Chromatin Immunoprecipitation Assay

The chromatin immunoprecipitation (ChIP) assay was performed using a kit from Upstate Biotechnologies (Lake Placid, NY) with the following modifications. Formaldehyde cross-linking was stopped with 125 mM glycine for 5 min at room temperature. After reversal of cross-links, eluates were precipitated overnight at −20°C with 2.5 vol of ethanol. Precipitated material was resuspended in 100 μl of TE and digested with 0.2 mg/ml proteinase K and 0.1 mg/ml DNase-free RNase A for 1 h at 45°C. DNA was purified using a QiaQuick spin column (Qiagen, Valencia, CA) and eluted with 30 μl of kit elution buffer, with 3 μl of the purified DNA used for PCR. An antibody against p65 (RelA c-19; Santa Cruz Biotechnology) was used to immunoprecipitate NF-κB–containing chromatin. PCR primers for the murine FasL promoter were derived from available sequence (GenBank accession no. AF045739) and were forward ACAGGCCTCTCAGGACACAC and reverse TAAGGTTTCCGCAGTCAAGG. These primers flank the only functional NF-κB site in the mouse promoter as previously identified (19). Positive control primers were for the IκBα promoter and have been described (33). Standard PCR (30 cycles) was performed with AmpliTaq Gold (Applied Biosystems, Foster City, CA) using the manufacturer’s recommended conditions with an annealing temperature of 50°C.

Statistical Analyses

All graphed data represent three independent experiments performed in triplicate. Data are presented as the average ± SD with probability determined by t test (two-tailed, two-sample equal variance).

Results

A possible role for Fas-mediated apoptosis in HIVAN has been suggested from in vitro infections of cultured tubular epithelial cells (9). To further this observation, we studied the in vivo expression pattern of Fas and FasL in human biopsy specimens and kidneys from the HIV-1 transgenic mouse model. In HIVAN biopsies, both cystic tubules and sclerosed glomeruli expressed abundant levels of Fas and FasL in comparison with normal nephrectomy tissue (Figure 1). In serial sections, it seemed that the same epithelium expressed both Fas and FasL, suggesting concurrent expression of both proteins. In comparison with both collapsing and noncollapsing idiopathic FSGS, the most abundant glomerular expression of Fas and FasL was observed in HIVAN. The most abundant tubular expression, however, was seen in noncollapsing FSGS, which would be consistent with a recent report by Erkan et al. (34). In glomeruli of both collapsing and noncollapsing idiopathic FSGS, focal areas of faint Fas staining were observed. This Fas expression co-localized with faint staining for FasL in collapsing idiopathic FSGS, whereas very little glomerular FasL expression was detected in noncollapsing FSGS.

Figure 1.
Figure 1.

Fas and Fas ligand (FasL) expression in HIV-associated nephropathy (HIVAN), collapsing and noncollapsing idiopathic focal segmental glomerulosclerosis (FSGS) biopsies, and normal nephrectomy tissue. Serial sections are shown for all except normal tissue. In HIVAN, immunolocalization for Fas and FasL expression appeared in similar areas of tubular epithelium (arrowheads), and expression of both proteins was abundant in glomeruli in a podocyte distribution. In collapsing idiopathic FSGS, staining for Fas and FasL could be detected in focal areas of glomerular epithelial cell hyperplasia (arrows) but at qualitatively lower levels as compared with HIVAN. In noncollapsing idiopathic FSGS, abundant expression of especially Fas was observed in tubules; however, the expression level in glomeruli was low in comparison. Expression in normal tissue was low for Fas and undetectable for FasL.

In the HIV-1 transgenic mouse model, the expression and distribution of Fas and FasL were compared between normal and diseased transgenic mouse kidneys (Figure 2). Similar to the human biopsies, cystic tubules and collapsed glomeruli had clearly elevated levels of Fas and FasL as compared with normal mouse kidney tissue. The glomerular expression seemed to be associated with podocytes, the glomerular cell type previously shown to be infected in the human disease and also the glomerular cell type that expresses the transgene in our mouse model. Thus, the cell types that express the HIV-1 genome are also the cells with evidence of elevated expression of Fas and FasL.

Figure 2.
Figure 2.

Fas and FasL expression in the HIV-1 transgenic mouse model. Immunohistochemistry for Fas and FasL expression in normal mouse kidneys (A and B) and in HIV-1 transgenic mouse kidneys with disease (C through F). Fas staining (A through D) was more abundant in the HIV-1 transgenic kidneys with pronounced staining in dilated tubules and in podocytes (arrowheads). FasL staining (E and F) was also very intense in the HIV-1 transgenic kidneys and was seen in dilated tubules and in a collapsed glomerulus (arrowhead). Sections were counterstained with hematoxylin.

To investigate this role of Fas-mediated apoptosis in HIVAN, we used podocyte cell lines that were established from normal and HIV-1 transgenic mice. With the use of a standard method to verify the mechanism of apoptosis involved in the Fas pathway, cultured podocytes were incubated with a Fas cross-linking antibody that artificially provides a stimulus to activate the Fas pathway. The induction of apoptosis was monitored both by caspase 8 activity and with a nuclear dye to detect both live and dead cells (Figure 3). By quantification of the number of pyknotic nuclei, there was a significantly higher basal level of apoptosis in HIVAN cells as compared with normal (approximately four-fold), which is consistent with previously reported apoptotic rates in HIV-1–infected podocytes (31). In addition, a statistically significant increase in the number of apoptotic cells in both cell types was observed with the addition of a cross-linking anti-Fas antibody (Figure 3B). Similarly, the basal level of caspase activity was significantly higher in the HIVAN podocytes as compared with normal (Figure 3C), suggesting the HIVAN podocytes have an existing caspase 8 stimulus that is absent or reduced in normal podocytes. Treatment with a standard dose (5 μg/ml) of the anti-Fas antibody similarly increased caspase activity in both cell types (Figure 3C); however, the maximal level of assayable caspase 8 activity was lower in the HIVAN cells at this dose and treatment interval. Preliminary survey experiments indicated that the normal and HIVAN cells responded differently depending on the dose and the length of treatment with the anti-Fas antibody. The HIVAN cells generated more caspase 8 activity at lower doses of anti-Fas, likely as a result of the higher expression of Fas (see below), and had less total caspase activity with longer treatment periods, likely reflecting the complete decomposition of apoptotic cells that died early in the treatment period that were missed by the end point assay (data not shown). These studies indicated that Fas is functionally expressed on both normal and HIVAN cells and that activation of the Fas pathway is at least one mechanism of apoptosis in podocytes. The anti-Fas antibody treatments also induced cell death as determined by the nuclear dye assay, which monitors the loss of plasma membrane integrity. This indicates that the increased caspase 8 activity is representative of later apoptotic events and cell death.

Figure 3.
Figure 3.

Fas-mediated apoptosis in normal and HIVAN podocytes. (A) Confluent cultures were treated with anti-Fas antibody, followed by detection of cell death using a fluorescence staining method. Bar = 20 μm. HIVAN podocytes are considerably smaller in size and do not spread as much as normal podocytes. Horizontal arrows indicate pyknotic nuclei; vertical arrows indicate mitotic figures. (B) Quantification of apoptosis shown in A for both untreated and anti-Fas antibody–treated (+αFas) normal and HIVAN podocytes. The nuclei with pyknotic changes (nonmitotic) were quantified as a percentage of total nuclei. (C) Normal and HIVAN podocytes were treated with an anti-Fas antibody (+αFas) and assayed for caspase 8 activity, the initiator caspase for Fas-mediated apoptosis. Treatment with a species- and isotype-matched control antibody (+Ab control) was not statistically different from untreated cells.

Because the immunohistochemistry results indicated that the levels of Fas and FasL are increased in vivo, the steady-state mRNA levels of Fas and FasL were compared between normal and HIVAN podocytes. Using semiquantitative reverse transcription–PCR technique (Figure 4A), both normal and HIVAN podocytes expressed Fas, and the level of Fas expression in the HIVAN podocyte was increased (approximately 10-fold) over normal. With this technique, however, there was no detectable basal expression of FasL in normal podocytes, but abundant expression was detected in HIVAN podocytes. This suggests that HIV-1 may induce de novo expression of FasL in podocytes. The mRNA level for both genes paralleled the protein expression levels as detected by Western blotting (Figure 4B). Thus, the composite of these studies with both human and mouse tissues and cells have consistently shown that in the setting of HIV-1 gene expression, Fas and FasL expression is elevated in renal epithelial cells. The observation that FasL expression was detected only in HIVAN podocytes may provide an explanation for the higher basal level of apoptosis detected by the caspase assays in Figure 3. In addition, because mRNA levels were elevated, it would be logical that a transcriptional event plays a fundamental role in the observed increased expression.

Figure 4.
Figure 4.

Fas and FasL gene expression in normal and HIVAN cultured podocytes. (A) Semiquantitative reverse transcription–PCR (RT-PCR) using varying amounts of input template cDNA (0.1 to 100 ng) normalized to the amplification of a housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]). The expression of Fas was increased approximately 10-fold in HIVAN podocytes. (B) Western blots comparing the Fas and FasL protein levels between normal (WT) and HIVAN podocytes (α-tubulin as a loading control).

We showed recently that HIV-1 expression in renal epithelial cells, similar to infected leukocytes, causes a persistent or constitutive activation of NF-κB (Bruggeman, unpublished observations). Previous studies have shown that the promoter for the FasL gene (human and mouse) contains functional NF-κB binding sites that are critical to its transcriptional regulation. Thus, these observations suggest a possible connection between the HIV-induced NF-κB activation and the increased FasL gene expression. To demonstrate functionally a role for NF-κB in FasL gene expression, we transfected normal and HIVAN podocytes with the pFasLTAL-SEAP reporter plasmid to measure FasL promoter activity (Figure 5A). In these transfections, the transcriptional activity of the FasL promoter was found to be higher in HIVAN podocytes as compared with normal podocytes. The basal promoter activity of the pTAL-SEAP reporter plasmid alone was 6673 ± 116 relative light units/105 cells and was not statistically different from the level of expression of the pFasLTAL-SEAP plasmid in normal podocytes. Thus, similar to the Northern and Western blots in Figure 4, essentially no expression of the FasL promoter was observed in normal podocytes. In addition, co-transfection of the pFasLTAL-SEAP with a constitutively expressed dominant negative IκBα, a strong inhibitor of NF-κB, resulted in reduced FasL promoter activity in the HIVAN cells. These studies suggest that NF-κB activation induces FasL expression in HIVAN podocytes and that suppression of NF-κB can reduce expression to the level seen in normal podocytes. To demonstrate further NF-κB’s role in FasL expression, we treated HIVAN podocytes with a soluble peptide inhibitor of NF-κB that blocks the ability of an activated NF-κB complex to bind target DNA sequences (Figure 5B). RNA was harvested and the expression of FasL mRNA was assayed by quantitative (real-time) PCR. Blocking NF-κB suppressed the HIV-1–induced increase in FasL expression in HIVAN podocytes by 10-fold, whereas a control treatment had no effect. Cell viability was lower for the SN50-treated cells, but FasL expression in all samples was normalized to GAPDH expression. The effect of NF-κB activity on FasL expression seemed to be a direct transcriptional regulation of the FasL gene as determined by ChIP assays, a method that identifies in vivo DNA–protein interactions. ChIP assays (Figure 5C) were performed in HIVAN podocytes using an antibody against p65 (RelA), the transactivating subunit of the NF-κB complex. The ChIP assay showed that RelA bound the FasL promoter within a defined region that contains the functional NF-κB site. These studies demonstrate that an NF-κB RelA-containing complex directly bound the FasL promoter in vivo and suggest that the status of NF-κB activation directly correlates with the level of FasL mRNA. The direct association of HIV-1–induced NF-κB activation and FasL gene expression suggests a mechanism for increased Fas-mediated apoptosis in HIVAN through the renal epithelial cell production of FasL.

Figure 5.
Figure 5.

Role of NF-κB in FasL gene expression. (A) Expression of a FasL promoter reporter plasmid in normal and HIVAN podocytes. Similar to the expression of the native FasL gene, the expression of the reporter construct was significantly higher in HIVAN podocytes as compared with normal (*P < 0.01). Co-transfection with a dominant negative mutant of IκBα (IκBαM) decreased the expression of the FasL reporter plasmid in HIVAN cells. (B) Inhibition of NF-κB activity reduced the steady-state mRNA level of FasL. HIVAN podocyte cultures were treated with a soluble peptide inhibitor of activated NF-κB, SN50, and also a control mutant peptide, SN50M. The expression of FasL was not significantly different between untreated (640 copies) and SN50M control-treated (561 copies) cells; however, the SN50 treatment significantly reduced FasL mRNA levels (60 copies) as compared with both the untreated and control-treated cells (*P < 0.05; **P < 0.005). (C) Chromatin immunoprecipitation (IP) assay using an anti-RelA (p65) antibody. Amplification of the IκBα promoter was used as a positive control. (D) For ruling out a potential effect of Fas/FasL signaling itself activating NF-κB, HIVAN podocytes were treated with a neutralizing FasL antibody (+αFasL), and RNA was harvested for RT-PCR. Various known direct NF-κB target genes were analyzed, including IL-6, FasL, and NF-κB p50, using semiquantitative PCR with serial dilutions of input template (GAPDH as a normalization control). There were no changes in the expression level of these direct NF-κB target genes with the inhibition of FasL/Fas signaling.

It was shown recently that Fas/FasL signaling, in addition to its well-known role in regulating apoptosis, may have additional, apoptosis-independent functions, such as participating in fibrosis and inflammation (35). With NF-κB’s central role in mediating inflammatory processes, it is possible that FasL signaling may be activating NF-κB in podocytes, as has been shown to occur in other cell types and some cancers (36–38). To exclude the possibility that the observed increases in NF-κB activation were in response to Fas/FasL signaling and not an HIV-1–induced event, we treated HIVAN podocytes with a neutralizing anti-FasL antibody (Figure 5D). After treatment, RNA was harvested and the expression level of three NF-κB target genes (IL-6, FasL, and NF-κB p50) was quantified to determine whether the treatment changed the expression level. The mRNA half-life for IL-6 is approximately 1 to 3 h (39). Because no change was observed in NF-κB target gene expression with this treatment, it suggests that Fas signaling is not making a significant contribution to the NF-κB activation state in HIVAN podocytes.

Discussion

During innate and acquired immune responses, many cells undergo apoptosis in response to viral infection. This results in the elimination of infected cells with a consequent reduction in the release of progeny virus. This protective response, however, comes at a high cost to the host, as abnormal apoptosis contributes to tissue destruction and pathogenesis. This is no more evident than during HIV-1 infection, in which the devastating effect on the immune system is due to the apoptotic killing of T helper lymphocytes (40,41). These cells are destroyed by both cytotoxic T lymphocyte–mediated killing of infected cells and also to a greater extent the killing of uninfected (bystander) cells via activation-induced cell death, a normal homeostatic process of the immune system mediated by Fas. HIV-1–induced apoptosis contributes to pathology in other organ systems as well, including cardiomyocyte cell death in HIV-1 cardiomyopathy and in central nervous system cell death, which contributes to AIDS dementia complex and HIV-induced encephalopathy (42–44). Similar to studies presented here, Ghorpade et al. (45) also implicated NF-κB–induced FasL expression as the likely mechanism of astrocyte cell death in AIDS dementia. This may suggest that HIV-induced Fas-mediated apoptosis is a common mechanism of cell death in nonlymphoid cell types and underscores the importance of the Fas pathway in host pathogenesis.

Our studies have centered on the HIV-induced NF-κB activation and its contribution to host cell dysfunction, such as the apoptotic defect in HIVAN. Although NF-κB has more well-known activities in protecting cells from apoptosis, it can also induce apoptosis through the upregulation of proapoptotic genes such as Fas and FasL. The ability of one transcription factor to participate in such mutually exclusive functions as being both proapoptotic and antiapoptotic stems from the fact that NF-κB is not a single transcription factor with one mechanism of activation. NF-κB is a multiprotein complex that is composed of either homo- or heterodimers of DNA binding subunits and transactivating subunits, which are bound by an inhibitor, IκB. Multiple genes code for these subunits, and 11 unique NF-κB dimers have been confirmed in vivo (20). The highly important IκB phosphorylation events occur through a multiprotein kinase complex that is known to participate in numerous signal transduction cascades (46). Cells typically express many NF-κB subunit proteins, and we have found that cultured podocytes express at least seven. Thus, the combinational diversity and multiple activation mechanisms of the NF-κB pathway even in a single cell type such as the podocyte is extraordinarily complex. It is possible that NF-κB activation in one setting could promote apoptosis and in another setting suppress apoptosis and would depend on the varied aspect of the NF-κB activation cascade, including the initiating stimulus and the composition of the NF-κB complex and its affinity for target gene enhancers.

That NF-κB can induce the expression of both Fas and FasL in one cell establishes a mechanism whereby FasL does not need to be supplied in trans via an immune cell or through the circulation. This dual expression of both Fas and FasL by epithelial cells seems to have a specific role in the immune response to many viral, bacterial, and parasitic infections. A study that investigated cytotoxic bacterial infections in the lung also found that the airway epithelial cells dually expressed both Fas and FasL to induce apoptosis (47). With the use of bone marrow reconstitution experiments using lpr (Fas-deficient) and gld (FasL-deficient) mutant mice, the apoptotic process was shown to be mediated exclusively by the Fas and FasL expressed by the epithelial cells and did not involve any contribution of FasL from the immune system. In the absence of this apoptotic response, all animals developed a lethal systemic infection. It was suggested that this mechanism inherent in lung epithelia was a critical innate immune response to limit the infection to a local area and prevent systemic spread. Thus, it may be possible that this increase in Fas-mediated apoptosis observed in HIVAN may be an intrinsic, first-line defense mechanism of renal epithelia in response to the infection or the presence of viral proteins.

Alternatively, this higher rate of apoptosis may reflect the abnormally high rate of proliferation also characteristic of HIVAN. Mechanisms that control proliferation and apoptosis share common cell-cycle regulatory proteins, and events that activate proliferation can also activate apoptosis (48). In the setting of a high proliferation rate, increased apoptosis is believed to function as a brake to delimit the maximal rate of proliferation and control tissue size (49). However, in HIVAN, even with an elevated apoptotic rate, the level of proliferation remains out of balance, resulting in a net increase in the overall size of the kidney, including podocyte hypertrophy, hyperplasia, and pseudocrescent formation. Therefore, a connection between apoptosis and proliferation in HIVAN may exist but likely represents a complicated relationship of varied aspects of host–virus interactions. One possible connection between these pathologic processes is the HIV-induced activation of NF-κB. Constitutive NF-κB activation has emerged as a hallmark of malignant transformation in lymphomas and solid organ tumors through the upregulation of cyclin D1, and it has been shown that the proliferative defect in HIVAN podocytes is a cyclin D1–dependent cell cycle progression (50,51). Thus, many aspects of HIVAN pathogenesis are likely to center on the dysregulation of NF-κB induced by the virus.

Whether the increased apoptosis in HIVAN is a compensatory mechanism in the setting of increased proliferation or an innate antiviral mechanism in the renal epithelial cells is currently under investigation. In either case, identification of the mechanism of NF-κB activation will be important in understanding HIVAN pathogenesis. This mechanism may involve specific effects of individual viral proteins’ interfering with signal transduction cascades that activate NF-κB–specific kinases. Recent studies have made a strong case for Nef as the likely candidate protein in the proliferative and dedifferentiation aspects of HIVAN pathogenesis (52,53). Alternatively NF-κB activation may result from systemic oxidative stress responses that are known to occur during HIV-1 infection (54). Reactive oxygen species can act as second messengers for activating NF-κB, released either systemically from activated immune cells in a general inflammatory process or through intracellular events that involve interactions with host redox–regulating molecules and individual viral proteins (55). With a better understanding of the role of specific viral proteins, as well as key host responses such as NF-κB activation, it may be possible to identify novel and specific targets for the treatment of HIVAN.

Acknowledgments

This work was presented in abstract form at the annual meeting of the American Society of Nephrology (St. Louis, MO; October 27 to November 1, 2004) and was supported by National Institutes of Health Grants DK61395 and DK62672.

We thank Drs. Jeffrey Schelling and Peter Nelson for critical review of the manuscript and Dr. Andrew O’Connor for assistance with the statistical analysis.

We dedicate this work to the memory of Ruth G. Abramson, MD (1934–2004).

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

References

  1. ↵
    Ross MJ, Klotman PE: HIV-associated nephropathy. AIDS 18 : 1089 –1099, 2004
    OpenUrlCrossRefPubMed
  2. ↵
    Kopp JB, Winkler C: HIV-associated nephropathy in African Americans. Kidney Int Suppl S43 –S49, 2003
  3. ↵
    Bruggeman LA, Ross MD, Tanji N, Cara A, Dikman S, Gordon RE, Burns GC, D’Agati VD, Winston JA, Klotman ME, Klotman PE: Renal epithelium is a previously unrecognized site of HIV-1 infection. J Am Soc Nephrol 11 : 2079 –2087, 2000
    OpenUrlAbstract/FREE Full Text
  4. ↵
    D’Agati V, Appel GB: Renal pathology of human immunodeficiency virus infection. Semin Nephrol 18 : 406 –421, 1998
    OpenUrlPubMed
  5. ↵
    Ross MJ, Bruggeman LA, Wilson PD, Klotman PE: Microcyst formation and HIV-1 gene expression occur in multiple nephron segments in HIV-associated nephropathy. J Am Soc Nephrol 12 : 2645 –2651, 2001
    OpenUrlAbstract/FREE Full Text
  6. ↵
    Yang Y, Gubler MC, Beaufils H: Dysregulation of podocyte phenotype in idiopathic collapsing glomerulopathy and HIV-associated nephropathy. Nephron 91 : 416 –423, 2002
    OpenUrlCrossRefPubMed
  7. ↵
    Barisoni L, Kriz W, Mundel P, D’Agati V: The dysregulated podocyte phenotype: A novel concept in the pathogenesis of collapsing idiopathic focal segmental glomerulosclerosis and HIV-associated nephropathy. J Am Soc Nephrol 10 : 51 –61, 1999
    OpenUrlAbstract/FREE Full Text
  8. Barisoni L, Bruggeman LA, Mundel P, D’Agati VD, Klotman PE: HIV-1 induces renal epithelial dedifferentiation in a transgenic model of HIV-associated nephropathy. Kidney Int 58 : 173 –181, 2000
    OpenUrlCrossRefPubMed
  9. ↵
    Conaldi PG, Biancone L, Bottelli A, Wade-Evans A, Racusen LC, Boccellino M, Orlandi V, Serra C, Camussi G, Toniolo A: HIV-1 kills renal tubular epithelial cells in vitro by triggering an apoptotic pathway involving caspase activation and Fas upregulation. J Clin Invest 102 : 2041 –2049, 1998
    OpenUrlCrossRefPubMed
  10. Bodi I, Abraham AA, Kimmel PL: Apoptosis in human immunodeficiency virus-associated nephropathy. Am J Kidney Dis 26 : 286 –291, 1995
    OpenUrlCrossRefPubMed
  11. Alpers CE: Light at the end of the TUNEL: HIV-associated thrombotic microangiopathy. Kidney Int 63 : 385 –396, 2003
    OpenUrlCrossRefPubMed
  12. ↵
    Kapasi AA, Patel G, Franki N, Singhal PC: HIV-1 gp120-induced tubular epithelial cell apoptosis is mediated through p38-MAPK phosphorylation. Mol Med 8 : 676 –685, 2002
    OpenUrlPubMed
  13. ↵
    Ortiz A, Lorz C, Egido J: New kids in the block: The role of FasL and Fas in kidney damage. J Nephrol 12 : 150 –158, 1999
    OpenUrlCrossRefPubMed
  14. ↵
    Zheng Y, Ouaaz F, Bruzzo P, Singh V, Gerondakis S, Beg AA: NF-kappa B RelA (p65) is essential for TNF-alpha-induced fas expression but dispensable for both TCR-induced expression and activation-induced cell death. J Immunol 166 : 4949 –4957, 2001
    OpenUrlAbstract/FREE Full Text
  15. Darville MI, Eizirik DL: Cytokine induction of Fas gene expression in insulin-producing cells requires the transcription factors NF-kappaB and C/EBP. Diabetes 50 : 1741 –1748, 2001
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Chan H, Bartos DP, Owen-Schaub LB: Activation-dependent transcriptional regulation of the human Fas promoter requires NF-kappaB p50–p65 recruitment. Mol Cell Biol 19 : 2098 –2108, 1999
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Crist SA, Griffith TS, Ratliff TL: Structure/function analysis of the murine CD95L promoter reveals the identification of a novel transcriptional repressor and functional CD28 response element. J Biol Chem 278 : 35950 –35958, 2003
    OpenUrlAbstract/FREE Full Text
  18. Holtz-Heppelmann CJ, Algeciras A, Badley AD, Paya CV: Transcriptional regulation of the human FasL promoter-enhancer region. J Biol Chem 273 : 4416 –4423, 1998
    OpenUrlAbstract/FREE Full Text
  19. ↵
    Matsui K, Fine A, Zhu B, Marshak-Rothstein A, Ju ST: Identification of two NF-kappaB sites in mouse CD95 ligand (Fas ligand) promoter: Functional analysis in T cell hybridoma. J Immunol 161 : 3469 –3473, 1998
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Chen LF, Greene WC: Shaping the nuclear action of NF-kappaB. Nat Rev Mol Cell Biol 5 : 392 –401, 2004
    OpenUrlCrossRefPubMed
  21. ↵
    Kucharczak J, Simmons MJ, Fan Y, Gelinas C: To be, or not to be: NF-kappaB is the answer—Role of Rel/NF-kappaB in the regulation of apoptosis. Oncogene 22 : 8961 –8982, 2003
    OpenUrlCrossRefPubMed
  22. ↵
    Campbell KJ, Rocha S, Perkins ND: Active repression of antiapoptotic gene expression by RelA(p65) NF-kappaB. Mol Cell 13 : 853 –865, 2004
    OpenUrlCrossRefPubMed
  23. ↵
    Karn J: Tackling Tat. J Mol Biol 293 : 235 –254, 1999
    OpenUrlCrossRefPubMed
  24. ↵
    Roulston A, Lin R, Beauparlant P, Wainberg MA, Hiscott J: Regulation of human immunodeficiency virus type 1 and cytokine gene expression in myeloid cells by NF-kappaB/Rel transcription factors. Microbiol Rev 59 : 481 –505, 1995
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Bruggeman LA, Adler SH, Klotman PE: Nuclear factor-kappaB binding to the HIV-1 LTR in kidney: Implications for HIV-associated nephropathy. Kidney Int 59 : 2174 –2181, 2001
    OpenUrlCrossRefPubMed
  26. ↵
    Dickie P, Felser J, Eckhaus M, Bryant J, Silver J, Marinos N, Notkins AL: HIV-associated nephropathy in transgenic mice expressing HIV-1 genes. Virology 185 : 109 –119, 1991
    OpenUrlCrossRefPubMed
  27. ↵
    Kopp JB, Klotman ME, Adler SH, Bruggeman LA, Dickie P, Marinos NJ, Eckhaus M, Bryant JL, Notkins AL, Klotman PE: Progressive glomerulosclerosis and enhanced renal accumulation of basement membrane components in mice transgenic for human immunodeficiency virus type 1 genes. Proc Natl Acad Sci U S A 89 : 1577 –1581, 1992
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Schwartz EJ, Cara A, Snoeck H, Ross MD, Sunamoto M, Reiser J, Mundel P, Klotman PE: Human immunodeficiency virus-1 induces loss of contact inhibition in podocytes. J Am Soc Nephrol 12 : 1677 –1684, 2001
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Mundel P, Reiser J, Zuniga M, Borja A, Pavenstadt H, Davidson GR, Kriz W, Zeller R: Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp Cell Res 236 : 248 –258, 1997
    OpenUrlCrossRefPubMed
  30. ↵
    Yao J, Le TC, Kos CH, Henderson JM, Allen PG, Denker BM, Pollak MR: Alpha-actinin-4-mediated FSGS: An inherited kidney disease caused by an aggregated and rapidly degraded cytoskeletal protein. PLoS Biol 2 : e167 , 2004
    OpenUrlCrossRefPubMed
  31. ↵
    Nelson PJ, Gelman IH, Klotman PE: Suppression of HIV-1 expression by inhibitors of cyclin-dependent kinases promotes differentiation of infected podocytes. J Am Soc Nephrol 12 : 2827 –2831, 2001
    OpenUrlAbstract/FREE Full Text
  32. ↵
    Ortiz-Arduan A, Danoff TM, Kalluri R, Gonzalez-Cuadrado S, Karp SL, Elkon K, Egido J, Neilson EG: Regulation of Fas and Fas ligand expression in cultured murine renal cells and in the kidney during endotoxemia. Am J Physiol 271 : F1193 –F1201, 1996
  33. ↵
    Yamamoto Y, Verma UN, Prajapati S, Kwak YT, Gaynor RB: Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423 : 655 –659, 2003
    OpenUrlCrossRefPubMed
  34. ↵
    Erkan E, Garcia CD, Patterson LT, Mishra J, Mitsnefes MM, Kaskel FJ, Devarajan P: Induction of renal tubular cell apoptosis in focal segmental glomerulosclerosis: Roles of proteinuria and Fas-dependent pathways. J Am Soc Nephrol 16 : 398 –407, 2005
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Jarad G, Wang B, Khan S, DeVore J, Miao H, Wu K, Nishimura SL, Wible BA, Konieczkowski M, Sedor JR, Schelling JR: Fas activation induces renal tubular epithelial cell beta 8 integrin expression and function in the absence of apoptosis. J Biol Chem 277 : 47826 –47833, 2002
    OpenUrlAbstract/FREE Full Text
  36. ↵
    Legembre P, Barnhart BC, Peter ME: The relevance of NF-kappaB for CD95 signaling in tumor cells. Cell Cycle 3 : 1235 –1239, 2004
    OpenUrlCrossRefPubMed
  37. Kreuz S, Siegmund D, Rumpf JJ, Samel D, Leverkus M, Janssen O, Hacker G, Dittrich-Breiholz O, Kracht M, Scheurich P, Wajant H: NFkappaB activation by Fas is mediated through FADD, caspase-8, and RIP and is inhibited by FLIP. J Cell Biol 166 : 369 –380, 2004
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Kataoka T, Budd RC, Holler N, Thome M, Martinon F, Irmler M, Burns K, Hahne M, Kennedy N, Kovacsovics M, Tschopp J: The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways. Curr Biol 10 : 640 –648, 2000
    OpenUrlCrossRefPubMed
  39. ↵
    Vannier E, Dinarello CA: Histamine enhances interleukin (IL)-1-induced IL-6 gene expression and protein synthesis via H2 receptors in peripheral blood mononuclear cells. J Biol Chem 269 : 9952 –9956, 1994
    OpenUrlAbstract/FREE Full Text
  40. ↵
    Gougeon ML, Montagnier L: Programmed cell death as a mechanism of CD4 and CD8 T cell deletion in AIDS. Molecular control and effect of highly active anti-retroviral therapy. Ann N Y Acad Sci 887 : 199 –212, 1999
    OpenUrlPubMed
  41. ↵
    Badley AD, Pilon AA, Landay A, Lynch DH: Mechanisms of HIV-associated lymphocyte apoptosis. Blood 96 : 2951 –2964, 2000
    OpenUrlAbstract/FREE Full Text
  42. ↵
    Twu C, Liu NQ, Popik W, Bukrinsky M, Sayre J, Roberts J, Rania S, Bramhandam V, Roos KP, MacLellan WR, Fiala M: Cardiomyocytes undergo apoptosis in human immunodeficiency virus cardiomyopathy through mitochondrion- and death receptor-controlled pathways. Proc Natl Acad Sci U S A 99 : 14386 –14391, 2002
    OpenUrlAbstract/FREE Full Text
  43. Xu Y, Kulkosky J, Acheampong E, Nunnari G, Sullivan, J, Pomerantz RJ: HIV-1-mediated apoptosis of neuronal cells: Proximal molecular mechanisms of HIV-1-induced encephalopathy. Proc Natl Acad Sci U S A 101 : 7070 –7075, 2004
    OpenUrlAbstract/FREE Full Text
  44. ↵
    Patel CA, Mukhtar, M, Pomerantz RJ: Human immunodeficiency virus type 1 Vpr induces apoptosis in human neuronal cells. J Virol 74 : 9717 –9726, 2000
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Ghorpade A, Holter S, Borgmann K, Persidsky R, Wu L: HIV-1 and IL-1 beta regulate Fas ligand expression in human astrocytes through the NF-kappaB pathway. J Neuroimmunol 141 : 141 –149, 2003
    OpenUrlCrossRefPubMed
  46. ↵
    Hayden MS, Ghosh S: Signaling to NF-kappaB. Genes Dev 18 : 2195 –2224, 2004
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Grassme H, Kirschnek S, Riethmueller J, Riehle A, von Kurthy G, Lang F, Weller M, Gulbins E: CD95/CD95 ligand interactions on epithelial cells in host defense to Pseudomonas aeruginosa. Science 290 : 527 –530, 2000
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Shankland SJ, Wolf G: Cell cycle regulatory proteins in renal disease: Role in hypertrophy, proliferation, and apoptosis. Am J Physiol Renal Physiol 278 : F515 –F529, 2000
    OpenUrlPubMed
  49. ↵
    Hipfner DR, Cohen SM: Connecting proliferation and apoptosis in development and disease. Nat Rev Mol Cell Biol 5 : 805 –815, 2004
    OpenUrlCrossRefPubMed
  50. ↵
    Foo SY, Nolan GP: NF-kappaB to the rescue: RELs, apoptosis and cellular transformation. Trends Genet 15 : 229 –235, 1999
    OpenUrlCrossRefPubMed
  51. ↵
    Nelson PJ, Sunamoto M, Husain M, Gelman IH: HIV-1 expression induces cyclin D1 expression and pRb phosphorylation in infected podocytes: Cell-cycle mechanisms contributing to the proliferative phenotype in HIV-associated nephropathy. BMC Microbiol 2 : e26 , 2002
  52. ↵
    He JC, Husain M, Sunamoto M, D’Agati VD, Klotman ME, Iyengar R, Klotman PE: Nef stimulates proliferation of glomerular podocytes through activation of Src-dependent Stat3 and MAPK1,2 pathways. J Clin Invest 114 : 643 –651, 2004
    OpenUrlCrossRefPubMed
  53. ↵
    Sunamoto M, Husain M, He JC, Schwartz EJ, Klotman PE: Critical role for Nef in HIV-1-induced podocyte dedifferentiation. Kidney Int 64 : 1695 –1701, 2003
    OpenUrlCrossRefPubMed
  54. ↵
    Stehbens WE: Oxidative stress in viral hepatitis and AIDS. Exp Mol Pathol 77 : 121 –132, 2004
    OpenUrlCrossRefPubMed
  55. ↵
    Nakamura H, Masutani H, Yodoi J: Redox imbalance and its control in HIV infection. Antioxid Redox Signal 4 : 455 –464, 2002
    OpenUrlCrossRefPubMed
View Abstract
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
NF-κB Regulates Fas-Mediated Apoptosis in HIV-Associated Nephropathy
Michael J. Ross, Scott Martinka, Vivette D. D’Agati, Leslie A. Bruggeman
JASN Aug 2005, 16 (8) 2403-2411; DOI: 10.1681/ASN.2004121101
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

More in this TOC Section

Cited By...

Similar Articles

Related Articles

  • No related articles found.