Pathophysiology of Renal Disease and Progression

Activation of Tubular Epithelial Cells in Diabetic Nephropathy and the Role of the Peroxisome Proliferator–Activated Receptor-γ Agonist

Sydney C.W. Tang, Joseph C.K. Leung, Loretta Y.Y. Chan, Anita W.L. Tsang and Kar Neng Lai
JASN June 2006, 17 (6) 1633-1643; DOI: https://doi.org/10.1681/ASN.2005101113

Abstract

The effects of advanced glycation end products (AGE) in the form of glycated albumin (GA) on the proinflammatory phenotype of cultured renal proximal tubular epithelial cells (PTEC) and the therapeutic potential of the peroxisome proliferator–activated receptor-γ (PPAR-γ) agonist were studied. Human PTEC were exposed to medium alone or supplemented with albumin or GA with or without previous addition of rosiglitazone (0.1 to 0.5 μM). Exposure to GA (up to 0.5 mg/ml) but not the equivalent dose of neat albumin significantly upregulated both mRNA and protein expression of IL-8 and soluble intercellular adhesion molecule-1 (sICAM-1) in a dose- and time-dependent manner. Using immunohistochemistry, ICAM-1 signals were detected in the tubular epithelia and peritubular capillaries in association with AGE deposition and leukocyte infiltration, whereas IL-8 staining was localized in the tubular epithelia of human diabetic kidney biopsies. Also in a dose-dependent manner, GA (0.5 mg/ml) but not albumin caused nuclear translocation of NF-κB and activation of mitogen-activated protein kinase (MAPK) p44/p42 and signal transducer and activator of transcription (STAT-1). Inhibition of these pathways with pyrrolidine dithiocarbamate, PD 98059, and fludarabine, respectively, attenuated GA-induced IL-8 secretion. Rosiglitazone dose-dependently attenuated GA-induced IL-8 and ICAM-1 signals in PTEC and completely abolished GA-induced STAT-1 signals but had no effect on NF-κB and MAPK activation. These findings suggest that AGE stimulate renal tubular expression of adhesion molecule and chemokine that together may account for the transmigration of inflammatory cells into the interstitial space during diabetic tubulopathy. Such proinflammatory phenotype may be partially modified by PPAR-γ ligation through STAT-1 inhibition independent of NF-κB transcriptional activity and MAPK signaling.

The growing epidemic of diabetes is affecting millions of people in affluent societies (1). In the United States, diabetes is now the primary diagnosis in 45% of the prevalent dialysis population (2). The rate of ESRD that is caused by diabetes has doubled since the early 1990s, and there is no evidence that it has peaked. Despite the clear and present burden of diabetes, knowledge of the mechanisms by which hyperglycemia contributes to kidney failure and its therapy remains limited (3). Advanced glycation end products (AGE) have been implicated in the pathogenesis of diabetic nephropathy (4–6). Gugliucci and Bendayan (7) demonstrated that AGE-containing proteins that are injected into rats are reabsorbed by proximal tubules, suggesting that renal handling of AGE is effected through uptake, either specifically or nonspecifically, by proximal tubular epithelial cells (PTEC). Recent animal studies have localized specific binding of AGE in the diabetic kidney primarily to the proximal tubule of the renal cortex (8). However, whether these binding sites represent receptors that are involved in the clearance of AGE or are linked to pathogenic pathways that lead to the development of diabetic nephropathy remains unclear. Furthermore, little is known about the action of AGE on PTEC, which actively reabsorb filtered proteins and peptides (9).

Peroxisome proliferator–activated receptors (PPAR) are a family of ligand-activated nuclear hormone receptors that belong to the steroid receptor superfamily (10). The antidiabetic thiazolidinedione group of drugs, such as troglitazone and rosiglitazone, are specific synthetic ligands of PPAR-γ, and this interaction is responsible for the insulin-sensitizing and hypoglycemic effect of these drugs, making them clinically useful for the treatment of type 2 diabetes (11). In addition, emerging data suggest that thiazolidinediones possess anti-inflammatory properties independent of their insulin-sensitizing action. These PPAR-γ agonists attenuate cellular inflammation that is associated with ischemia-reperfusion tissue injury in myocardial and cerebrovascular diseases (12,13), suppress airway inflammation in murine models of lung injury (14), and even reduce disease in an experimental model of acute pancreatitis (15). In the kidney, PPAR-γ agonists have been shown to abrogate ischemia-reperfusion injury (16) and proliferative mesangial diseases (17) and halt diabetic glomerulosclerosis by blocking mesangial expansion (18). However, it is not known whether PPAR-γ agonists have any effect on tubulointerstitial inflammation, which is a major determinant of renal function in the chronically diseased kidney regardless of the primary insult (19) and is orchestrated predominantly by the proinflammatory phenotype of the PTEC (20–23).

In this study, we hypothesize that AGE activate PTEC to enter a proinflammatory state that may contribute to the tubulointerstitial changes that inevitably are observed in the chronic diabetic kidney. From a therapeutic perspective, we postulate that the PPAR-γ agonist may ameliorate intrarenal inflammation by regulating the inflammatory phenotype of PTEC in the diabetic state. The putative signal transduction pathways also were examined.

Materials and Methods

Reagents

Medium, reagents for cell culture, antibodies for cell characterization, BSA, NF-κB inhibitor pyrrolidine dithiocarbamate (PDTC), and general chemicals were purchased from Sigma Chemicals (Poole, Paisley, UK). The endotoxin level in all albumin preparations was <10 EU/ml as determined using the QCL-1000 Limulus Amebocyte Lysate (LAL) kit (BioWhittaker Inc., Walkersville, MD). Antibiotics, sera, agarose, and DNA size markers were obtained from Life Technologies BRL (Paisley, UK). Reagents for cDNA synthesis were obtained from Life Technologies and Promega (Madison, WI), and those for PCR and cycle sequencing were from Perkin Elmer (Branchburg, NJ). Enzyme immunoassay kit for detection of IL-8, IL-6, monocyte chemoattractant protein-1 (MCP-1), and soluble intercellular adhesion molecule-1 (sICAM-1) were purchased from Bender MedSystems (Vienna, Austria). Reagents and antibodies for nuclear extraction, oligonucleotide labeling, and NF-κB detection by gel shift were from Pierce (Rockford, IL). Antibodies to phospho-p42/42 mitogen-activated protein kinase (MAPK) and phospho-signal transducer and activator of transcription-1 (STAT-1) were obtained from Cell Signaling Technology (Beverly, MA). The extracellular signal–regulated kinase 1/2 (ERK1/2) inhibitor PD 98059 and the STAT-1 inhibitor fludarabine were from Sigma. All other antibodies were from Dako A/S (Glostrup, Denmark). The synthetic PPAR-γ agonist rosiglitazone was obtained from GlaxoSmithKline (Compound Management Division, Stevenage, Herts, UK).

Cell Culture

To mimic the diabetic milieu in vitro, we exposed human PTEC to AGE in the form of glycated BSA (GA) or BSA as control. Human PTEC were isolated according to a previously described method (24). Briefly, renal cortical tissue was obtained from kidneys that were removed for circumscribed tumors, which has been approved by the Hong Kong Hospital Authority Research Ethics Committee. Histologic examination of these kidney samples revealed no renal pathology. Cortical specimens were cut into small cubes and passed through a series of mesh sieves of diminishing pore size. PTEC were collected on the 53-μm sieve and digested with collagenase (750 U/ml) at 37°C for 15 min. Tubular cells were isolated by centrifugation and grown in a 1:1 mixture of DMEM and Ham’s F12 medium supplemented with 10% FCS, hydrocortisone (40 ng/ml), l-glutamine (2 mM), benzyl penicillin (100 IU/ml), and streptomycin (100 μg/ml). The cells were incubated at 37°C in 5% CO2 and 95% air. They were characterized to be of proximal tubular origin by immunofluorescence and enzyme histochemistry: Cells that stained positively for cytokeratin, vimentin, and alkaline phosphatase but negatively for Tamm-Horsfall glycoprotein, factor VIII–related antigen, and α-smooth muscle actin. Scanning electron microscopy demonstrated the presence of numerous apical microvilli of a rudimentary brush border with reassembly of tight junctions. Experiments were performed with cells up to the third passage, because it has been shown that there are no phenotypic changes up to this passage number (25). In all experiments, there was a “growth arrest” period of 24 h in serum-free medium before stimulation. Results were obtained from PTEC that were cultured from the kidney of three different donors.

Preparation of GA

BSA (Fraction V; Sigma Chemical Co., St. Louis, MO) was passed over an affinity Gel Blue column (Bio-Rad Inc., Hercules, CA), a heparin Sepharose CL6B column (Pharmacia, Arlington, IL), and an endotoxin-binding affinity column (Pierce) to remove possible contaminants. BSA that was modified by advanced glycation (GA) was prepared as described elsewhere (26). Briefly, BSA was incubated with 0.5 M d-glucose in 0.2 M phosphate buffer (pH 7.4) at 37°C for 8 wk under sterile conditions, and then low molecular weight reactants and glucose were removed by dialysis against PBS. BSA that was incubated without glucose was used as control BSA for all experiments.

RNA Extraction and cDNA Synthesis

Total RNA was extracted from PTEC monolayers by a modification of the method by Chomczynski and Sacchi (27). Briefly, cells were lysed in a commercially available lysis buffer, which contained a mixture of phenol and guanidinium thiocyanate in a monophasic solution (RNA Isolator; Genosys Biotechnologies, Cambridge, UK). This was followed by chloroform extraction and isopropanol precipitation. RNA was quantified by absorbance at 260 nm. Five micrograms of total RNA was reverse transcribed to cDNA with Superscript II reverse transcriptase (Life Technologies, Paisley, UK) in a 20-μl reaction mixture that contained 160 ng oligo (dT)12-18, 500 μM of each dNTP, and 40 U RNase inhibitor for 10 min at 37°C, 60 min at 42°C, and 5 min at 99°C. cDNA was stored at −20°C until further use.

Analysis of Cytokine Gene Expression

Confluent, growth-arrested PTEC were incubated in serum-free medium alone, medium that contained 0.5 mg/ml BSA, or 0.5 mg/ml GA with or without previous addition of rosiglitazone (0.1 to 0.5 μM). After 6 h, cells were lysed for reverse transcription–PCR to determine gene expression of IL-6, IL-8, MCP-1, and ICAM-1. The cDNA primer oligonucleotide sequences were designed from GenBank. The oligonucleotide sequences were as follows: IL-8, forward ATG ACT TCC AAG CTG GCC GTG CT, reverse TCT CAG CCC TCT TCA AAA ACT TCT; ICAM-1, forward GAG ACC CCG TTG CCT AAA, reverse CCG CAG GTC CAG TTC AGT; MCP-1, forward AGT CTC TGC CGC CCT TCT GT, reverse CCC CAA GTC TCT GTA TCT AA; IL-6, forward ATG AAC TCC TTC TCC ACA AGC GC, reverse GAA GAG CCC TCA GGC TGG ACT G. These yielded amplified PCR products of 298 (IL-8), 399 (ICAM-1), 499 (MCP-1), and 628 bp (IL-6). PCR reactions were carried out in a DNA thermal cycler (MJ Research, Watertown, MA), with 28 to 30 cycles of amplification at an annealing temperature of 55 to 59°C. For quantification, human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers were included in every reaction as an internal control. The PCR products were separated by 1.5% wt/vol agarose gels and stained with ethidium bromide (Sigma), and the gel image was captured and analyzed using the Gel Doc 1000 Densitometry System and Quantity One (Bio-Rad Laboratories Ltd., Hercules, CA). The product yield was expressed as a ratio to glyceraldehyde-3-phosphate dehydrogenase.

Assay of Cytokine Secretion in Culture Supernatants

Confluent, growth-arrested PTEC were incubated in serum-free medium alone, medium that contained 0.5 mg/ml BSA, or 0.5 mg/ml GA with or without previous addition of rosiglitazone (0.1 to 0.5 μM). After 24 h, cells were counted, and culture supernatants were stored at −70°C until protein assay. Detection of IL-8, sICAM-1, MCP-1, and IL-6 level in culture supernatants was carried out on a commercially available assay kit according to the manufacturer’s instructions (Bender MedSystems, Vienna, Austria). The detection sensitivity and intra-assay coefficient of variation is 11 pg/ml ± 3.8% for IL-8, 0.63 ng/ml ± 6.8% for sICAM-1, 74 pg/ml ± 8.9% for MCP-1, and 1.4 pg/ml ± 5.4% for IL-6.

Immunohistochemical Localization of ICAM-1 and IL-8 Expression on Human Diabetic Kidneys

To localize the site of ICAM-1 and IL-8 production in vivo, we performed immunohistochemical staining on renal biopsy tissues that were obtained from patients with diabetic (n = 5 with three men; age range 58 to 73 yr; duration of diabetes 2 to 6.5 yr; daily proteinuria 2.4 to 11 g; serum creatinine 1.46 to 4.07 mg/dl) and nondiabetic nonproliferative glomerulopathies, including minimal-change nephrotic syndrome (n = 10) and hypertensive nephrosclerosis (n = 4), and from patients with histology of no or minor abnormality (n = 7) as control.

Paraffin-embedded human kidney tissues were sectioned at a thickness of 4 μm, and the sections were deparaffinized with xylene and then rehydrated through a descending gradient of ethanol. ICAM-1 and IL-8 expression on paraffin sections was determined by immunohistochemical staining using monoclonal anti-human ICAM-1 and IL-8 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Briefly, the slides were incubated with 0.5% H2O2 for removal of endogenous peroxidase activity. Nonspecific binding was blocked by incubation of the slides for 30 min with blocking buffer (5% normal goat serum and 3% BSA in PBS). The sections then were incubated with anti–ICAM-1 (10 μg/ml) or anti–IL-8 (10 μg/ml) antibodies overnight. The bound murine antibodies were visualized using the Dako Envision Plus System (Dako, Carpinteria, CA). Antibodies that were preabsorbed with ICAM-1–or IL-8–immunizing peptides were used as controls, as appropriate.

To demonstrate that upregulation of tubular ICAM-1 was associated with AGE deposition and leukocytic infiltration in human diabetic nephropathy, we performed double immunohistochemical staining of CD45-positive cells and ICAM-1 or AGE and ICAM-1 expression in tubules. Kidney section of diabetic nephropathy first was incubated with anti–ICAM-1 or anti-CD45 and color-developed with 3,3-diaminobenzidine (brown color) as described above. The section then was heated with universal decloaker solution using a decloaking chamber for 10 min to denature bound antibodies and prevent antibody cross-reaction. The section then was stained with anti-AGE or anti–ICAM-1 followed by MACH 3 mouse probe alkaline phosphatase polymer kit and developed with Ferangi Blue Chromogen System (Biocare Medical, Walnut Creek, CA).

Electrophoretic Mobility Shift Assay for NF-κB Detection

To study a possible relationship between albumin-induced tubular inflammation and the transcriptional factor NF-κB, we performed standard electrophoretic mobility shift assay (EMSA). PTEC were plated on T75 tissue culture flask and, upon confluence, treated with BSA (0.5 mg/ml) or GA (0.5 mg/ml). At the end of the 1-h incubation, nuclear extract was prepared using NE-PER nuclear extraction reagent (Pierce) and stored at −70°C until assay. Gel shift oligonucleotide for NF-κB (AGTTGAGGGGACTTTCCCAGGC; the core sequence is in italics) was biotinylated using Biotin 3′ end labeling kit (Pierce), and the EMSA was carried out with the LightShift chemiluminescent EMSA kit (Pierce) according to the manufacturer’s instruction. To explore whether the PPAR-γ agonist may exert its anti-inflammatory effect through NF-κB inhibition, we performed parallel experiments with rosiglitazone (0.5 μM, added 30 min before the addition of 0.1 or 0.5 mg/ml GA). In addition, PTEC were treated with PDTC (25 μM, added 30 min before the addition of GA), which is known to inhibit NF-κB activation (28), as an NF-κB inhibitory control. Cells that were treated with PDTC alone without albumin and extracts that were treated with unlabeled κB oligonucleotide also were included as negative controls.

Western Blot Analysis of p42/p44 MAPK and STAT-1 Signal Transduction

Besides NF-κB, the MAPK are among the most evolutionarily conserved signaling pathways that are important in many pathophysiologic processes in immune response. There are data that both p42/44 and p38 MAPK are activated in the diabetic rat kidney in a high-glucose milieu (29). However, whether AGE might also activate the MAPK cascade is unknown. PTEC that were grown on T75 tissue culture flask were treated with serum-free medium alone or supplemented with BSA (0.5 mg/ml), GA (0.1 or 0.5 mg/ml), or rosiglitazone (0.5 μM, added 30 min before the addition of GA). After 30 min, cells were lysed with lysis buffer that contained protease inhibitor cocktails (Sigma). The cell extracts were pelleted at 150,000 × g for 60 min to remove cell debris. The protein concentrations were measured by a modified Lowry method using BSA as standard (DC Protein Assay Kit; Bio-Rad). Ten micrograms of total protein from the extract or immunoprecipitated pellet from 106 cells was electrophoresed through a 15% SDS-PAGE gel before being transferred to a polyvinylidene difluoride membrane. After blocking for 1 h at room temperature in blocking buffer (1% gelatin in PBS with 0.05% Tween-20), the membrane was incubated for 16 h with rabbit anti-phospho p42/p44 MAPK or anti-phospho STAT-1 (1:1000) in PBS-Tween. The membrane was washed and incubated for 2 h at room temperature with a peroxidase-labeled goat anti-rabbit Ig (Dako). A loading control using anti-unphosphorylated protein was included. After further washing, the membrane was detected with ECL chemiluminescence (Amersham Pharmacia Biotech, Arlington, IL).

Statistical Analyses

All data were expressed as means ± SD unless otherwise specified. Statistical analysis was performed using SPSS v.12.0 for Windows (SPSS, Inc., Chicago, IL). Intergroup differences for continuous variables were assessed by multivariate ANOVA with Bonferroni correction for repeated measures. P < 0.05 was considered statistically significant.

Results

Proinflammatory Phenotype in PTEC

At the quiescent state, PTEC expressed IL-6, IL-8, MCP-1, and ICAM-1 constitutively. Acute exposure to glycated albumin (0.5 mg/ml) but not the equivalent dose of albumin for 6 h upregulated the transcripts of IL-8 and ICAM-1 but not those of IL-6 and MCP-1 (Figure 1). After 24 h of exposure, secretion of IL-8 and sICAM-1 proteins but not those of IL-6 and MCP-1 into culture supernatants also was stimulated (Figure 2). GA (0.5 to 4 mg/ml) induced tubular IL-8 and ICAM-1 mRNA expression in a dose- and time-dependent manner (Figures 3 and 4). At doses that reached 2 to 4 mg/ml, IL-8 expression also was excited by albumin. ICAM-1 transcripts remained inert to higher doses of albumin. Rosiglitazone alone (0.1 or 0.5 μM) or in combination with BSA (0.5 mg/ml) did not alter the production of these molecules by PTEC and served as additional negative controls.

Figure 1.
Figure 1.

Tubular expression of IL-6 (A), IL-8 (B), monocyte chemoattractant protein-1 (MCP-1; C), and soluble intercellular adhesion molecule-1 (sICAM-1; D) mRNA after acute exposure to glycated albumin (GA) and the effect of peroxisome proliferator–activated receptor-γ (PPAR-γ) agonist. Confluent, growth-arrested cells were exposed for 6 h to serum-free medium alone or supplemented with BSA (0.5 mg/ml) or with GA (0.5 mg/ml) with or without rosiglitazone (0.1 or 0.5 μM) added 1 h before. The experimental conditions are summarized at the bottom. Results are means ± SD obtained from triplicate experiments.

Figure 2.
Figure 2.

Tubular secretion of IL-6 (A), IL-8 (B), MCP-1 (C), and sICAM-1 (D) protein after acute exposure to GA and the effect of PPAR-γ agonist. Confluent, growth-arrested cells were exposed for 24 h to serum-free medium alone or supplemented with BSA (0.5 mg/ml) or with GA (0.5 mg/ml) with or without rosiglitazone (0.1 or 0.5 μM) added 1 h before. The experimental conditions are summarized at the bottom. Results are means ± SD obtained from triplicate experiments.

Figure 3.
Figure 3.

Dose effect of albumin (○) or GA (•) on tubular mRNA expression of IL-8 (A) and ICAM-1 (B) after incubation for 6 h. Results are means ± SD obtained from triplicate experiments. *P = 0.003, †P < 0.001, ‡P = 0.017, §P = 0.004, φP = 0.002, #P = 0.04 versus growth-arrested cells incubated in serum-free medium alone. Typical gels showing the corresponding PCR products are shown at the top of each panel.

Figure 4.
Figure 4.

Time response of tubular mRNA expression of IL-8 (A) and ICAM-1 (B) to GA (0.5 mg/ml) stimulation. Results are means ± SD obtained from triplicate experiments. *P = 0.007, †P < 0.001, ‡P = 0.001 versus time 0 control. Typical gels showing the corresponding PCR products are shown at the top of each panel.

Tissue Localization of ICAM-1 and IL-8 Expression in the Diabetic Kidney

To confirm ICAM-1 expression in vivo, we immunohistochemically stained paraffin sections of human renal biopsy specimens from individuals with and without diabetes using a specific mAb. As depicted in Figure 5, sections from patients with a histologic diagnosis of diabetic nephropathy showed strong ICAM-1 signals in the proximal tubules, particularly toward the apical membrane, and peritubular capillaries. Furthermore, tubular ICAM-1 signals were associated with deposition of AGE and infiltration of CD45-positive leukocytes. Conversely, sections from patients with nonproliferative glomerulopathies (minimal-change nephrotic syndrome and hypertensive nephrosclerosis) displayed weak ICAM-1 staining, whereas patients with kidney histology of no or minor abnormality as control had minimal ICAM-1 signals in the tubules. We previously demonstrated a similar degree of tubular IL-8 expression in vivo in patients with diabetic glomerulosclerosis, minimal-change nephrotic syndrome, and hypertensive nephrosclerosis, whereas patients with minor glomerular abnormality had minimal tubular IL-8 (23).

Figure 5.
Figure 5.

Immunohistochemical staining for ICAM-1 in human renal tissue. Representative staining from patients with diabetic nephropathy (A) showed intense signals in proximal tubules, particularly toward the apical membrane, and in peritubular capillaries (arrows). Double immunohistochemical staining for advanced glycation end products (AGE) and ICAM-1 (B) showed co-localization of AGE (in blue) and ICAM-1 (in brown) signals (arrowheads) in the tubules. Double immunohistochemical staining for CD45-positive leukocytes and ICAM-1 (C) demonstrated leukocyte infiltration (in brown) of the interstitial space in close association with ICAM-1–expressing tubules (in blue). Representative sections from patients with hypertensive nephrosclerosis (D) and minimal-change nephrotic syndrome (E) showed weak signals, whereas only minimal background staining was present in renal tissue with minor glomerular abnormality (F). Magnification, ×100, all counterstained with hematoxylin.

Effect of PPAR-γ Agonist on Tubular Inflammation

To study the effect of PPAR-γ ligation, we treated PTEC with rosiglitazone (0.1 to 0.5 μM) for 1 h before and during incubation with GA (0.5 mg/ml). Rosiglitazone dose-dependently attenuated GA-induced upregulation of IL-8 and ICAM-1 expression at both transcriptional and posttranscriptional levels (Figures 1 and 2).

Activation of NF-κB

To investigate whether the induction of IL-8 and ICAM-1 in PTEC by GA was mediated via the transcription factor NF-κB, we performed EMSA with nuclear extracts of growth-arrested PTEC that were treated for 1 h with BSA or GA. As depicted in Figure 5, translocation of NF-κB into the cell nucleus of PTEC occurred after exposure to GA but not BSA. In addition, GA activated NF-κB in a dose-dependent manner, as shown by the more intense shifting signal when cells were exposed to 0.5 mg/ml compared with 0.1 mg/ml of GA (Figure 6). Cells that were treated with PDTC alone and extracts that were treated with unlabeled κB oligonucleotide demonstrated no shifting of the NF-κB complex (electrophoretic gel not shown).

Figure 6.
Figure 6.

Activation of NF-κB by GA and the effect of the PPAR-γ agonist. Electrophoretic mobility shift assay was performed with nuclear extracts of growth-arrested proximal tubular epithelial cells (PTEC) treated for 1 h with serum-free medium alone or supplemented with BSA (0.5 mg/ml), GA (0.5 mg/ml), rosiglitazone (ROS; 0.5 μM, added 30 min before the addition of 0.1 or 0.5 mg/ml GA), or pyrrolidine dithiocarbamate (PDTC; 25 μM, added 30 min before the addition of 0.1 or 0.5 mg/ml GA). The results shown are representative of three independent experiments.

Activation of MAPK

To investigate whether the induction of IL-8 and ICAM-1 in PTEC by GA also was mediated by the p42/p44 MAPK signal transduction pathway, we subjected cell extracts of PTEC that were probed with anti-phospho p42/p44 MAPK to Western blot analyses. Activation of both MAPK p42/p44 subunits was evident after exposure to GA but not BSA for 30 min in a dose-dependent manner (Figure 7).

Figure 7.
Figure 7.

Detection of phospho-p42 and phospho-p44 subunits of mitogen-activated protein kinase (MAPK). Western blot analyses of cell extracts of PTEC that were probed with anti-phospho p42/p44 MAPK after 30-min exposure to BSA, GA, or ROS (0.5 μM, added 30 min before the addition of 0.1 or 0.5 mg/ml GA). A loading control using anti-unphosphorylated protein was included. The results shown are representative of three independent experiments.

Activation of JAK/STAT-1 Proteins

To study whether the induction of IL-8 and ICAM-1 in PTEC by GA was dependent on STAT-1 signaling, we subjected cell extracts of GA-exposed PTEC that were probed with anti-phospho STAT-1 to Western blot analyses. As depicted in Figure 8, exposure to GA but not BSA for 30 min induced STAT-1 in a dose-dependent manner.

Figure 8.
Figure 8.

Detection of phospho signal transducer and activator of transcription (pSTAT-1) protein. Western blot analyses of cell extracts of PTEC probed with anti-phospho STAT-1 after 30-min exposure to BSA, GA, or ROS (0.5 μM, added 30 min before the addition of 0.1 or 0.5 mg/ml GA). A loading control using anti-unphosphorylated protein was included. The results shown are representative of three independent experiments.

Inhibition of NF-κB, MAPK, and JAK/STAT-1

To substantiate the role of NF-κB, MAPK, and JAK/STAT-1 signal transduction pathways in mediating GA-induced IL-8 ad ICAM-1 secretion, we pretreated cells with PDTC, PD 98059, and fludarabine, respectively, 1 h before exposure to GA. All three inhibitors were capable of significantly attenuating GA-induced IL-8 secretion by PTEC (Figure 9). Although the degree of inhibition was less marked for ICAM-1 secretion, cells that were pretreated with any of the three inhibitors showed reduced ICAM-1 secretion to levels that were similar to medium control (Figure 9).

Figure 9.
Figure 9.

Effect of NF-κB, MAPK, and STAT-1 inhibition on GA-induced IL-8 and ICAM-1 secretion in PTEC. Confluent PTEC were treated for 24 h with medium alone (control), GA (0.5 mg/ml), PDTC (25 μM, added 1 h before the addition of GA), PD 98059 (25 μM, added 1 h before addition of GA), or fludarabine (25 μM, added 1 h before addition of GA). At the end of incubation, IL-8 (□) and ICAM-1 (□) levels in culture supernatants were assayed by ELISA and corrected for cell number. Results are means ± SD of triplicate experiments and expressed as percentage of medium control of the corresponding protein. *P < 0.001, **P = 0.02 versus medium control; †P < 0.001, ‡P = 0.002, §P = 0.027 versus cells treated with GA alone.

Effect of PPAR-γ Agonist on Signal Transduction Pathways

To explore whether the anti-inflammatory effects of the PPAR-γ agonist is mediated through intracellular signaling pathways that are known to control the expression of inflammatory genes, we performed parallel experiments such that PTEC were treated with rosiglitazone (0.5 μM) for 30 min before and during incubation with GA (0.1 or 0.5 mg/ml). As shown in Figure 6, rosiglitazone had no effect on GA-induced nuclear translocation of the NF-κB complex. Cells that were pretreated with PDTC, which is known to inhibit NF-κB activation, served as positive control, whereas cells that were treated with PDTC alone or unlabeled κB oligonucleotide demonstrated no shifting of the NF-κB complex by EMSA (electrophoretic gel not shown). In addition, rosiglitazone did not affect GA-induced activation of phospho-p42 and phospho-p44 subunits of MAPK (Figure 7). Conversely, STAT-1 signaling was completely abolished by rosiglitazone that was added 30 min before PTEC were treated with GA (Figure 8).

Discussion

Despite ample data implicating AGE in the pathogenesis of diabetic nephropathy, knowledge on their role in tubulopathy, a major determinant of renal outcome (19), in diabetes is limited. Here we studied the effect of AGE in the form of glycated albumin on the tubular expression of IL-6, IL-8, MCP-1, and ICAM-1. The rationale for choosing these four candidate genes stems from evidence demonstrating their participation in the pathogenesis of diabetic nephropathy (30–32). Because neat albumin has been shown to stimulate tubular expression of at least MCP-1 (20) and IL-8 (23) in vitro, we used much lower doses of albumin (0.1 to 0.5 mg/ml), at which it exerts hardly any effect on the expression of these chemokines. Therefore, any effect triggered by the same protein load using GA could be attributed virtually entirely to the glycation of albumin.

We showed for the first time that GA but not the equivalent dose of BSA that served as control stimulated tubular IL-8 and ICAM-1, whereas IL-6 and MCP-1 signals remained unaffected. IL-8 and ICAM-1 are known to activate leukocytes and macrophages to sites of inflammation. Although diabetic nephropathy generally is not regarded as an inflammatory disorder, this view is changing because recent studies of human biopsy specimens and animal models have established glomerular macrophage accumulation (33,34) and juxtaglomerular T cell infiltration (35) as some of the cardinal features of diabetic nephropathy. These studies, however, fail to account for the infiltration by inflammatory cells into the interstitial compartment of the diabetic kidney. Our finding of GA-induced tubular IL-8 and ICAM-1 signals may provide insight into the mechanism of such phenomena. IL-8 is a prototype chemokine of the C-X-C family that has potent chemotactic activity at nanomolar and picomolar concentrations for neutrophils and lymphocytes, respectively (36), and induces leukocyte transendothelial transmigration (37), whereas ICAM-1 is a cell-surface glycoprotein of the Ig superfamily that is involved in the firm attachment of leukocytes to the endothelium (38), which interacts with lymphocyte function–associated antigen-1 (CD11a/CD18) and Mac-1 (CD11b/CD18) that are present on most leukocytes. Therefore, the infiltration of leukocytes into the renal interstitial space in diabetes may be mediated by sequential binding to ICAM-1 and IL-8 release that together promote rolling, arrest, firm adhesion, and, ultimately, transmigration.

Although our findings could not be extrapolated directly to the in vivo scenario, four pieces of evidence support the contention that GA-induced, tubule-secreted IL-8 and ICAM-1 strategically orchestrate the influx of inflammatory cells into the renal interstitium and induce injury: (1) Demonstration here of ICAM-1 expression in renal tubules and peritubular capillaries together with its co-localization with infiltrating leukocytes and AGE in the human diabetic kidney, although the significance of its apical topography, also reported in other models of renal interstitial inflammation (39–41), remains to be defined; (2) ICAM-1–deficient diabetic mice had markedly reduced interstitial leukocyte infiltration, tubular damage, interstitial fibrosis, albuminuria, and better renal function compared with their ICAM-1–intact counterparts (31,42); (3) Detection of renal tubular IL-8 signals with interstitial infiltrating CD44+ leukocytes in humans with diabetic glomerulosclerosis (23), and tubular IL-8 signals with interstitial CD68+ macrophages in an animal model of type 2 diabetes–related nephropathy (43); and (4) Detection of urinary IL-8 in patients with type 2 diabetes and a correlation between its level and the severity of diabetes (32). To our knowledge, there has not been a model of an IL-8–deficient diabetic animal for analysis, but the strategic role of IL-8 in vivo may be inferred indirectly from animal studies in which the administration of a neutralizing anti–IL-8 antibody prevented albuminuria and glomerular infiltration of neutrophils (44).

Whereas albumin is known to activate NF-κB (21,23,45), ERK (46), and STAT (47) pathways in PTEC, the signal transduction pathways that are switched on by GA are not well understood. Morcos et al. (30) reported NF-κB activation in vitro by AGE-albumin as well as in PTEC that were excreted in the urine of 40% of patients with type 2 diabetes. Here, we confirmed the capacity of GA in turning on NF-κB in PTEC dose dependently. In addition, we demonstrated that whereas neat albumin led to low-grade activation of the two isoforms of the ERK p42/p44, GA stimulated ERK1 and ERK2 even further, and the activation occurred in a dose-dependent manner. This is not surprising considering that the MAPK are ubiquitous messengers that form an integral component of the innate immune response in which ERK activation is heavily involved in T cell activation and inflammation (48). Finally, STAT-1, which belongs to a family of nuclear proteins that mediate the action of numerous cytokines, is critically involved in different pathologies that are correlated to the inflammatory process, such as conversion of IFN-γ signals into gene expression of vascular cellular adhesion molecule and ICAM. Of relevance to diabetic nephropathy, JAK-2 and STAT-1 proteins were a prerequisite for AGE-induced production of extracellular matrix molecules in kidney fibroblasts (49) and for hyperglycemia-induced expression of TGF-β and fibronectin in glomerular mesangial cells (50). Whether AGE also perturb STAT-1 proteins in PTEC remains unknown. Here, we showed that the STAT-1 proteins in PTEC were recruited by GA dose dependently. In addition, the role of NF-κB, MAPK, and JAK/STAT-1 signal transduction pathways in mediating GA-induced IL-8 and ICAM-1 secretion in PTEC is supported further by specific inhibitors that blocked such secretion.

From a therapeutic perspective, despite modern diabetes management of hyperglycemia and BP control using angiotensin II receptor blockers, many patients still sustain progressive renal damage (51). Inhibition of IL-8 and blockade of NF-κB, MAPK, and JAK/STAT signaling cascades using specific antagonists (44,50,52–54) are only at the experimental stage and limited to animal models of kidney diseases, and their application in clinical practice still is premature. Thiazolidinediones are a relatively new class of insulin-sensitizing drugs that stimulate PPAR-γ activity. They have been shown to possess additional anti-inflammatory properties in a variety of nondiabetic conditions (12–16), deactivate macrophage (55), and reduce fibrotic markers in PTEC that are exposed to high glucose (56) and hence may offer a therapeutic opportunity for diabetic renal disease. Here we showed that rosiglitazone dose-dependently attenuated GA-induced IL-8 and ICAM-1 mRNA and secretion in PTEC. In addition, there was a trend that MCP-1 expression was reduced by rosiglitazone, compatible with its role in tubulointerstitial inflammation as a result of excessive protein trafficking (20). Whereas rosiglitazone was shown recently to downregulate renal tubular ICAM-1 expression in a murine sepsis model (57), its immunosuppressive effects on IL-8 and ICAM-1 induced by GA in PTEC have not been reported before.

Indeed, PPAR-γ regulates gene expression by forming a heterodimer with the retinoid X receptor before binding to sequence-specific PPAR response elements in the promoter region of target genes, thereby regulating several metabolic pathways, including lipid biosynthesis and glucose metabolism. PPAR-γ agonists may exert their anti-inflammatory effects by negatively regulating the expression of proinflammatory genes (transcriptional transrepression) through inhibition of transcriptional factors such as NF-κB (58). Here, such a phenomenon could not be reproduced in GA-treated PTEC that were preincubated with rosiglitazone. Nevertheless, this is in agreement with the recent observation that pioglitazone limits LDL-induced inflammation and d-glucose–induced fibrosis in PTEC independent of NF-κB transcriptional activity (56,59). In addition to NF-κB activation, MAPK is another signal transduction network that was implicated recently in diabetic tubulopathy in which LLC-PK1 cells, a porcine PTEC line, manifest a profibrotic phenotype under high-glucose milieu (60). However, stimulation of PPAR-γ in GA-treated PTEC also failed to suppress MAPK activation. Conversely, rosiglitazone completely abolished STAT-1 signaling in PTEC that were exposed to GA. Taken together, the interruption of STAT-1 but not NF-κB or MAPK signals by rosiglitazone could explain why the PPAR-γ ligand did not completely reverse the effects of GA on PTEC.

Conclusion

This study is the first to show that GA stimulates tubular IL-8 and ICAM-1 expression via NF-κB–, MAPK-, and STAT-1–dependent pathways, which could account for the population of the renal interstitium by inflammatory cells in the diabetic kidney. Such proinflammatory phenotype may be modified partially by engagement of the PPAR-γ with rosiglitazone that abolishes STAT-1 stimulation but not NF-κB transcription or MAPK signaling by GA. The availability of PPAR-γ–selective agonists affords a new therapeutic approach to the management of diabetic tubulopathy. Future research should be geared toward the design of agents that also nullify NF-κB and MAPK activation.

Acknowledgments

This work was supported by the Research Grant Council (grant HKU 7452/04M) of Hong Kong and a grant from the Hong Kong Society of Nephrology. Rosiglitazone was a kind gift from GlaxoSmithKline (Compound Management Division, Stevenage, Herts, UK).

This study was presented in abstract form at the American Society of Nephrology Renal Week, November 10 to 13, 2005, in Philadelphia, PA.

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

References

  1. ↵
    Zimmet P, Alberti KG, Shaw J: Global and societal implications of the diabetes epidemic. Nature 414 : 782–787, 2001
    OpenUrlCrossRefPubMed
  2. ↵
    US Renal Data System: US Renal Data System 2004 Report. Available: http://www.usrds.org/2004/
  3. ↵
    Brownlee M: Biochemistry and molecular cell biology of diabetic complications. Nature 414 : 813–820, 2001
    OpenUrlCrossRefPubMed
  4. ↵
    Brownlee M: Lilly Lecture 1993. Glycation and diabetic complications. Diabetes 43 : 836–841, 1994
    OpenUrlFREE Full Text
  5. Bucala R, Vlassara H: Advanced glycosylation end products in diabetic renal and vascular disease. Am J Kidney Dis 26 : 875–888, 1995
    OpenUrlPubMed
  6. ↵
    Vlassara H, Striker LJ, Teichberg S, Fuh H, Li YM, Steffes M: Advanced glycation end products induce glomerular sclerosis and albuminuria in normal rats. Proc Natl Acad Sci U S A 91 : 11704–11708, 1994
    OpenUrlAbstract/FREE Full Text
  7. ↵
    Gugliucci A, Bendayan M: Renal fate of circulating advanced glycated end products (AGE): Evidence for reabsorption and catabolism of AGE-peptides by renal proximal tubular cells. Diabetologia 39 : 149–160, 1996
    OpenUrlCrossRefPubMed
  8. ↵
    Youssef S, Nguyen DT, Soulis T, Panagiotopoulos S, Jerums G, Cooper ME: Effect of diabetes and aminoguanidine therapy on renal advanced glycation end-product binding. Kidney Int 55 : 907–916, 1999
    OpenUrlCrossRefPubMed
  9. ↵
    Christensen EI, Nielsen S: Structural and functional features of protein handling in the kidney proximal tubule. Semin Nephrol 11 : 414–439, 1991
    OpenUrlPubMed
  10. ↵
    Evans RM: The steroid and thyroid hormone receptor superfamily. Science 240 : 889–895, 1988
    OpenUrlAbstract/FREE Full Text
  11. ↵
    Lebovitz HE, Dole JF, Patwardhan R, Rappaport EB, Freed MI: Rosiglitazone monotherapy is effective in patients with type 2 diabetes. J Clin Endocrinol Metab 86 : 280–288, 2001
    OpenUrlCrossRefPubMed
  12. ↵
    Sidhu JS, Cowan D, Kaski JC: Effects of rosiglitazone on endothelial function in men with coronary artery disease without diabetes mellitus. Am J Cardiol 94 : 151–156, 2004
    OpenUrlCrossRefPubMed
  13. ↵
    Sundararajan S, Landreth GE: Antiinflammatory properties of PPARgamma agonists following ischemia. Drug News Perspect 17 : 229–236, 2004
    OpenUrlCrossRefPubMed
  14. ↵
    Birrell MA, Patel HJ, McCluskie K, Wong S, Leonard T, Yacoub MH, Belvisi MG: PPAR-gamma agonists as therapy for diseases involving airway neutrophilia. Eur Respir J 24 : 18–23, 2004
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Cuzzocrea S, Pisano B, Dugo L, Ianaro A, Britti D, Patel NS, Di Paola R, Genovese T, Di Rosa M, Caputi AP, Thiemermann C: Rosiglitazone, a ligand of the peroxisome proliferator-activated receptor-gamma, reduces acute pancreatitis induced by cerulein. Intensive Care Med 30 : 951–956, 2004
    OpenUrlCrossRefPubMed
  16. ↵
    Sivarajah A, Chatterjee PK, Patel NS, Todorovic Z, Hattori Y, Brown PA, Stewart KN, Mota-Filipe H, Cuzzocrea S, Thiemermann C: Agonists of peroxisome-proliferator activated receptor-gamma reduce renal ischemia/reperfusion injury. Am J Nephrol 23 : 267–276, 2003
    OpenUrlCrossRefPubMed
  17. ↵
    Ghosh SS, Gehr TW, Ghosh S, Fakhry I, Sica DA, Lyall V, Schoolwerth AC: PPARgamma ligand attenuates PDGF-induced mesangial cell proliferation: Role of MAP kinase. Kidney Int 64 : 52–62, 2003
    OpenUrlCrossRefPubMed
  18. ↵
    McCarthy KJ, Routh RE, Shaw W, Walsh K, Welbourne TC, Johnson JH: Troglitazone halts diabetic glomerulosclerosis by blockade of mesangial expansion. Kidney Int 58 : 2341–2350, 2000
    OpenUrlCrossRefPubMed
  19. ↵
    Nath KA: Tubulointerstitial changes as a major determinant in the progression of renal damage. Am J Kidney Dis 20 : 1–17, 1992
    OpenUrlCrossRefPubMed
  20. ↵
    Wang Y, Chen J, Chen L, Tay YC, Rangan GK, Harris DC: Induction of monocyte chemoattractant protein-1 in proximal tubule cells by urinary protein. J Am Soc Nephrol 8 : 1537–1545, 1997
    OpenUrlAbstract
  21. ↵
    Zoja C, Donadelli R, Colleoni S, Figliuzzi M, Bonazzola S, Morigi M, Remuzzi G: Protein overload stimulates RANTES production by proximal tubular cells depending on NF-kappa B activation. Kidney Int 53 : 1608–1615, 1998
    OpenUrlCrossRefPubMed
  22. Tang S, Sheerin NS, Zhou W, Brown Z, Sacks SH: Apical proteins stimulate complement synthesis by cultured human proximal tubular epithelial cells. J Am Soc Nephrol 10 : 69–76, 1999
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Tang S, Leung JC, Abe K, Chan KW, Chan LY, Chan TM, Lai KN: Albumin stimulates interleukin-8 expression in proximal tubular epithelial cells in vitro and in vivo. J Clin Invest 111 : 515–527, 2003
    OpenUrlCrossRefPubMed
  24. ↵
    Detrisac CJ, Sens MA, Garvin AJ, Spicer SS, Sens DA: Tissue culture of human kidney epithelial cells of proximal tubule origin. Kidney Int 25 : 383–390, 1984
    OpenUrlCrossRefPubMed
  25. ↵
    Phillips AO, Steadman R, Topley N, Williams JD: Elevated D-glucose concentrations modulate TGF-beta 1 synthesis by human cultured renal proximal tubular cells. The permissive role of platelet-derived growth factor. Am J Pathol 147 : 362–374, 1995
    OpenUrlPubMed
  26. ↵
    Yang CW, Vlassara H, Peten EP, He CJ, Striker GE, Striker LJ: Advanced glycation end products up-regulate gene expression found in diabetic glomerular disease. Proc Natl Acad Sci U S A 91 : 9436–9440, 1994
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162 : 156–159, 1987
    OpenUrlCrossRefPubMed
  28. ↵
    Schreck R, Meier B, Mannel DN, Droge W, Baeuerle PA: Dithiocarbamates as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp Med 175 : 1181–1194, 1992
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Kang MJ, Wu X, Ly H, Thai K, Scholey JW: Effect of glucose on stress-activated protein kinase activity in mesangial cells and diabetic glomeruli. Kidney Int 55 : 2203–2214, 1999
    OpenUrlCrossRefPubMed
  30. ↵
    Morcos M, Sayed AA, Bierhaus A, Yard B, Waldherr R, Merz W, Kloeting I, Schleicher E, Mentz S, Abd el Baki RF, Tritschler H, Kasper M, Schwenger V, Hamann A, Dugi KA, Schmidt AM, Stern D, Ziegler R, Haering HU, Andrassy M, van der Woude F, Nawroth PP: Activation of tubular epithelial cells in diabetic nephropathy. Diabetes 51 : 3532–3544, 2002
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Okada S, Shikata K, Matsuda M, Ogawa D, Usui H, Kido Y, Nagase R, Wada J, Shikata Y, Makino H: Intercellular adhesion molecule-1-deficient mice are resistant against renal injury after induction of diabetes. Diabetes 52 : 2586–2593, 2003
    OpenUrlAbstract/FREE Full Text
  32. ↵
    Tashiro K, Koyanagi I, Saitoh A, Shimizu A, Shike T, Ishiguro C, Koizumi M, Funabiki K, Horikoshi S, Shirato I, Tomino Y: Urinary levels of monocyte chemoattractant protein-1 (MCP-1) and interleukin-8 (IL-8), and renal injuries in patients with type 2 diabetic nephropathy. J Clin Lab Anal 16 : 1–4, 2002
    OpenUrlCrossRefPubMed
  33. ↵
    Sassy-Prigent C, Heudes D, Mandet C, Belair MF, Michel O, Perdereau B, Bariety J, Bruneval P: Early glomerular macrophage recruitment in streptozotocin-induced diabetic rats. Diabetes 49 : 466–475, 2000
    OpenUrlAbstract
  34. ↵
    Chow F, Ozols E, Nikolic-Paterson DJ, Atkins RC, Tesch GH: Macrophages in mouse type 2 diabetic nephropathy: Correlation with diabetic state and progressive renal injury. Kidney Int 65 : 116–128, 2004
    OpenUrlCrossRefPubMed
  35. ↵
    Moriya R, Manivel JC, Mauer M: Juxtaglomerular apparatus T-cell infiltration affects glomerular structure in type 1 diabetic patients. Diabetologia 47 : 82–88, 2004
    OpenUrlCrossRefPubMed
  36. ↵
    Larsen CG, Anderson AO, Appella E, Oppenheim JJ, Matsushima K: The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes. Science 243 : 1464–1466, 1989
    OpenUrlAbstract/FREE Full Text
  37. ↵
    Zoja C, Angioletti S, Donadelli R, Zanchi C, Tomasoni S, Binda E, Imberti B, te Loo M, Monnens L, Remuzzi G, Morigi M: Shiga toxin-2 triggers endothelial leukocyte adhesion and transmigration via NF-kappaB dependent up-regulation of IL-8 and MCP-1. Kidney Int 62 : 846–856, 2002
    OpenUrlCrossRefPubMed
  38. ↵
    Staunton DE, Marlin SD, Stratowa C, Dustin ML, Springer TA: Primary structure of ICAM-1 demonstrates interaction between members of the immunoglobulin and integrin supergene families. Cell 52 : 925–933, 1988
    OpenUrlCrossRefPubMed
  39. ↵
    Shappell SB, Mendoza LH, Gurpinar T, Smith CW, Suki WN, Truong LD: Expression of adhesion molecules in kidney with experimental chronic obstructive uropathy: The pathogenic role of ICAM-1 and VCAM-1. Nephron 85 : 156–166, 2000
    OpenUrlCrossRefPubMed
  40. Hill PA, Lan HY, Nikolic-Paterson DJ, Atkins RC: ICAM-1 directs migration and localization of interstitial leukocytes in experimental glomerulonephritis. Kidney Int 45 : 32–42, 1994
    OpenUrlPubMed
  41. ↵
    Wuthrich RP, Jevnikar AM, Takei F, Glimcher LH, Kelley VE: Intercellular adhesion molecule-1 (ICAM-1) expression is upregulated in autoimmune murine lupus nephritis. Am J Pathol 136 : 441–450, 1990
    OpenUrlPubMed
  42. ↵
    Chow FY, Nikolic-Paterson DJ, Ozols E, Atkins RC, Tesch GH: Intercellular adhesion molecule-1 deficiency is protective against nephropathy in type 2 diabetic db/db mice. J Am Soc Nephrol 16 : 1711–1722, 2005
    OpenUrlAbstract/FREE Full Text
  43. ↵
    Blanco S, Vaquero M, Gomez-Guerrero C, Lopez D, Egido J, Romero R: Potential role of angiotensin-converting enzyme inhibitors and statins on early podocyte damage in a model of type 2 diabetes mellitus, obesity, and mild hypertension. Am J Hypertens 18 : 557–565, 2005
    OpenUrlCrossRefPubMed
  44. ↵
    Wada T, Tomosugi N, Naito T, Yokoyama H, Kobayashi K, Harada A, Mukaida N, Matsushima K: Prevention of proteinuria by the administration of anti-interleukin 8 antibody in experimental acute immune complex-induced glomerulonephritis. J Exp Med 180 : 1135–1140, 1994
    OpenUrlAbstract/FREE Full Text
  45. ↵
    Wang Y, Rangan GK, Tay YC, Harris DC: Induction of monocyte chemoattractant protein-1 by albumin is mediated by nuclear factor kappaB in proximal tubule cells. J Am Soc Nephrol 10 : 1204–1213, 1999
    OpenUrlAbstract/FREE Full Text
  46. ↵
    Reich H, Tritchler D, Herzenberg AM, Kassiri Z, Zhou X, Gao W, Scholey JW: Albumin activates ERK via EGF receptor in human renal epithelial cells. J Am Soc Nephrol 16 : 1266–1278, 2005
    OpenUrlAbstract/FREE Full Text
  47. ↵
    Nakajima H, Takenaka M, Kaimori JY, Hamano T, Iwatani H, Sugaya T, Ito T, Hori M, Imai E: Activation of the signal transducer and activator of transcription signaling pathway in renal proximal tubular cells by albumin. J Am Soc Nephrol 15 : 276–285, 2004
    OpenUrlAbstract/FREE Full Text
  48. ↵
    Dong C, Davis RJ, Flavell RA: MAP kinases in the immune response. Annu Rev Immunol 20 : 55–72, 2002
    OpenUrlCrossRefPubMed
  49. ↵
    Huang JS, Guh JY, Chen HC, Hung WC, Lai YH, Chuang LY: Role of receptor for advanced glycation end-product (RAGE) and the JAK/STAT-signaling pathway in AGE-induced collagen production in NRK-49F cells. J Cell Biochem 81 : 102–113, 2001
    OpenUrlCrossRefPubMed
  50. ↵
    Wang X, Shaw S, Amiri F, Eaton DC, Marrero MB: Inhibition of the Jak/STAT signaling pathway prevents the high glucose-induced increase in TGF-beta and fibronectin synthesis in mesangial cells. Diabetes 51 : 3505–3509, 2002
    OpenUrlAbstract/FREE Full Text
  51. ↵
    Svensson M, Sundkvist G, Arnqvist HJ, Bjork E, Blohme G, Bolinder J, Henricsson M, Nystrom L, Torffvit O, Waernbaum I, Ostman J, Eriksson JW: Signs of nephropathy may occur early in young adults with diabetes despite modern diabetes management: Results from the nationwide population-based Diabetes Incidence Study in Sweden (DISS). Diabetes Care 26 : 2903–2909, 2003
    OpenUrlAbstract/FREE Full Text
  52. ↵
    Cugini D, Azzollini N, Gagliardini E, Cassis P, Bertini R, Colotta F, Noris M, Remuzzi G, Benigni A: Inhibition of the chemokine receptor CXCR2 prevents kidney graft function deterioration due to ischemia/reperfusion. Kidney Int 67 : 1753–1761, 2005
    OpenUrlCrossRefPubMed
  53. Rangan GK, Wang Y, Tay YC, Harris DC: Inhibition of nuclear factor-kappaB activation reduces cortical tubulointerstitial injury in proteinuric rats. Kidney Int 56 : 118–134, 1999
    OpenUrlCrossRefPubMed
  54. ↵
    Tojo A, Onozato ML, Kobayashi N, Goto A, Matsuoka H, Fujita T: Antioxidative effect of p38 mitogen-activated protein kinase inhibitor in the kidney of hypertensive rat. J Hypertens 23 : 165–174, 2005
    OpenUrlCrossRefPubMed
  55. ↵
    Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK: The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature 391 : 79–82, 1998
    OpenUrlCrossRefPubMed
  56. ↵
    Panchapakesan U, Sumual S, Pollock CA, Chen X: PPAR gamma agonists exert antifibrotic effects in renal tubular cells exposed to high glucose. Am J Physiol Renal Physiol 289 : F1153–F1158, 2005
    OpenUrlCrossRefPubMed
  57. ↵
    Lee S, Kim W, Kang KP, Moon SO, Sung MJ, Kim DH, Kim HJ, Park SK: Agonist of peroxisome proliferator-activated receptor-gamma, rosiglitazone, reduces renal injury and dysfunction in a murine sepsis model. Nephrol Dial Transplant 20 : 1057–1065, 2005
    OpenUrlCrossRefPubMed
  58. ↵
    Poynter ME, Daynes RA: Peroxisome proliferator-activated receptor alpha activation modulates cellular redox status, represses nuclear factor-kappaB signaling, and reduces inflammatory cytokine production in aging. J Biol Chem 273 : 32833–32841, 1998
    OpenUrlAbstract/FREE Full Text
  59. ↵
    Zafiriou S, Stanners SR, Polhill TS, Poronnik P, Pollock CA: Pioglitazone increases renal tubular cell albumin uptake but limits proinflammatory and fibrotic responses. Kidney Int 65 : 1647–1653, 2004
    OpenUrlCrossRefPubMed
  60. ↵
    Fujita H, Omori S, Ishikura K, Hida M, Awazu M: ERK and p38 mediate high-glucose-induced hypertrophy and TGF-beta expression in renal tubular cells. Am J Physiol Renal Physiol 286 : F120–F126, 2004
    OpenUrlCrossRefPubMed
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Activation of Tubular Epithelial Cells in Diabetic Nephropathy and the Role of the Peroxisome Proliferator–Activated Receptor-γ Agonist
Sydney C.W. Tang, Joseph C.K. Leung, Loretta Y.Y. Chan, Anita W.L. Tsang, Kar Neng Lai
JASN Jun 2006, 17 (6) 1633-1643; DOI: 10.1681/ASN.2005101113
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section