BASIC RESEARCH

Intramolecular Epitope Spreading in Heymann Nephritis

Pallavi Shah, Alfonso Tramontano and Sudesh P. Makker
JASN December 2007, 18 (12) 3060-3066; DOI: https://doi.org/10.1681/ASN.2007030342

Abstract

Immunization with megalin induces active Heymann nephritis, which reproduces features of human idiopathic membranous glomerulonephritis. Megalin is a complex immunological target with four discrete ligand-binding domains (LBDs) that may contain epitopes to which pathogenic autoantibodies are directed. Recently, a 236-residue N-terminal fragment, termed “L6,” that spans the first LBD was shown to induce autoantibodies and severe disease. We used this model to examine epitope-specific contributions to pathogenesis. Sera obtained from rats 4 weeks after immunization with L6 demonstrated reactivity only with the L6 fragment on Western blot, whereas sera obtained after 8 weeks demonstrated reactivity with all four recombinant fragments of interest (L6 and LBDs II, III, and IV). We demonstrated that the L6 immunogen does not contain the epitopes responsible for the reactivity to the LBD fragments. Therefore, the appearance of antibodies directed at LBD fragments several weeks after the primary immune response suggests intramolecular epitope spreading. In vivo, we observed a temporal association between increased proteinuria and the appearance of antibodies to LBD fragments. These data implicate B cell epitope spreading in antibody-mediated pathogenesis of active Heymann nephritis, a model that should prove valuable for further study of autoimmune dysregulation.

Active Heymann nephritis (AHN) reproduces immunohistologic and clinical presentation of human membranous glomerulonephritis, including glomerular immune deposits (ID), proteinuria, and nephrotic syndrome. AHN is inducible by immunization with crude renal extracts and more recently with purified rat megalin, the principal target of autoantibodies (autoAb) in glomerular ID.1 Specific antimegalin responses in AHN and production of passive Heymann nephritis (PHN) with monospecific antimegalin antisera support a role for autoAb in disease progression2,3; however cell-mediated immunity has also been implicated in the pathogenesis.4–6 The autoantigen in the common variety of idiopathic human membranous glomerulonephritis is unknown, although in a few neonatal cases, the neutral endopeptidase on podocytes was identified as the target antigen of maternal alloantibodies.7

Megalin presents a complex immunologic target, presenting epitopes involved in propagating autoimmunity as well as those involved in deposition of autoAb. A structural organization consisting of four discrete ligand-binding domains (LBD I through IV) is critical to its function as an endocytic receptor.8–10 Previous studies11,12 assigned significance to specific epitopes within these LBD, which could be targets for “pathogenic” autoAb. Efforts to induce AHN with a fusion protein containing a short sequence of LBD II produced glomerular ID but no evidence of nephrotic disease or proteinuria.13 Domain-specific rabbit antisera generated against recombinant polypeptides representing LBD I through IV produced glomerular ID in PHN without induction of proteinuria or other clinical consequences.14 More recently, N-terminal fragments spanning LBD I produced either by proteolysis of native megalin15 or by expression in baculovirus-insect cells16 were shown to be as effective as native megalin for inducing AHN. A fragment including residues 1 to 236 induced autoAb and full-blown disease characterized by glomerular ID and severe proteinuria.17 This study used this model to examine the role of epitope-specific responses in pathogenesis. Immune responses confined to a small fragment would implicate specific determinants in the molecule that mediate disease. Alternatively, further diversification of the immune response by epitope spreading might be required for pathogenesis.

B cell epitope spreading has been described in systemic18–20 and organ-specific21–23 autoimmune disease models as well as in human disease.24–26 Recently, autoAb suggesting intra- and intermolecular epitope spreading were observed in experimental autoimmune glomerulonephritis (EAG) induced with a peptide of the α3 chain of type IV collagen22,27; however, the significance for disease is unclear because this model can also develop without detectable glomerular ID.28,29 Deposition of high-affinity autoAb to megalin is the hallmark of AHN. Spreading could therefore reveal the contribution of diversified autoAb to disease progression. For this purpose, recombinant polypeptides representing LBD of megalin were used as antigens to probe specificities of autoAb induced with N-terminal fragments of varying nephritogenicity.

RESULTS

Production and Characterization of Megalin Fragments LBD II, III, and IV

Recombinant polypeptides representing epitopes of three cysteine-rich LBD of rat megalin approximated those previously prepared and used to generate domain-specific antisera.14 DNA fragments encoding LBD II, III, and IV were obtained by PCR amplification, and each fragment was cloned in the pFASTBac bacmid vector for integration in baculovirus constructs. High-Five insect cells infected with the recombinant baculoviruses were shown to express fragments of the correct size as determined by Western blot with anti-6xHis mAb (Figure 1A). Purification by affinity chromatography on Ni-NTA resin in the presence of 5 mM mercaptoethanol improved binding and recovery of the proteins, suggesting that inappropriate disulfide cross-linkage inhibited binding to the 6xHis tag. Identities of the polypeptides were confirmed by mass spectrometry/mass spectrometry (MS/MS) analysis of tryptic fragments eluted from in-gel digests of samples resolved by SDS-PAGE. Immunoblot analysis with rat antimegalin antiserum collected at 12 wk from rats with AHN specifically stained all three proteins corresponding to those identified by anti-tag blot (Figure 1B). By ELISA, this antiserum had approximately three-fold greater reactivity against the N-terminal and C-terminal fragments as compared with the two internal fragments (Figure 1C).

Figure 1.
Figure 1.

Identification of L6, LBD II, LBD III, and LBD IV (theoretical molecular weight 27148, 66906, 83890, and 79442 Da, respectively) by immunoblot with anti-His6 mAb and with rat antimegalin antiserum. Megalin fragments L6, LBD II, LBD III, and LBD IV were loaded (5 μg/lane) and resolved by SDS-PAGE under reducing conditions, and proteins were transferred to polyvinylidene difluoride. Membranes were stained with anti–His6-HRP mAb at a dilution of 1:10,000 (A) or with rat antimegalin antiserum diluted at 1:5000 followed by goat anti-rat IgG-HRP at 1:10,000 dilution (B). (C) Titers of 12-wk antisera collected from rats that had AHN and were immunized with rat megalin determined against the four recombinant fragments adsorbed on microtiter plates.

B Cell Epitope Spreading in Anti-L6 Antisera

Sera from Lewis rats immunized with L6 obtained as described previously17 were diluted 1:5000 for immunoblot of membranes loaded with L6, LBD II, LBD III, and LBD IV. The 4-wk antiserum stained L6 but not the LBD fragments; however, antisera collected at 8 and 12 wk after immunization reacted with all four fragments (Figure 2A). In two subsequent experiments, groups of six rats were immunized with L6, as before, and sera were collected at 3, 6, and 9 wk. Three-week antisera from all rats in both groups reacted only with L6 as described previously. Six-week sera in one group reacted weakly with all fragments, whereas those of the second group showed only trace or no reaction. The 9-wk sera of all rats in both groups stained all four fragments.

Figure 2.
Figure 2.

Immunoblots of recombinant megalin fragments L6, LBD II, LBD III, and LBD IV prepared according to the legend to Figure 1. (A) Membranes were stained with antisera of L6-immunized rats collected 4, 8, and 12 wk. (B) Membranes were stained with 12-wk anti-L6 antiserum diluted as described, in buffer containing L6 (top) or native rat megalin (bottom), each at a concentration of 15 μg/ml.

Immunoblots were performed as described using 1:5000 diluted 12-wk antisera in the presence of soluble L6 or megalin from Lewis rat kidney. Staining of L6 on the membrane was completely inhibited by L6, whereas staining of LBD fragments was unaffected. By contrast, staining of all antigens was blocked in the presence of megalin (Figure 2B).

Proliferation of Lymph Node Cells from Rats with AHN

Lymph nodes of L6-immunized rats collected at 12 wk were used to prepare lymph node cells (LNC) for in vitro proliferation assay. Cells were incubated in the presence of approximately equal amounts, by weight, of L6 or LBD II, III, or IV. Proliferation was strongly stimulated in the presence of Con A, and L6 and LBD IV also induced comparable proliferation; cells incubated in the presence LBD II or III showed only minimal levels of proliferation (Figure 3).

Figure 3.
Figure 3.

Proliferation of LNC from L6-immunized rats stimulated with recombinant fragments. LNC collected from rats at 12 wk after immunization were incubated in the presence of L6, LBD II, LBD III, or LBD IV (20 μg/ml each). Cells were pulsed with 3H-thymidine, and uptake was determined as described in the Concise Methods section.

Correlation of Epitope Spreading with Disease

Onset of proteinuria in rats immunized with L6 was seen at 6 to 8 wk with further acceleration at 10 to 12 wk (Figure 4A). ELISA of antisera indicated peak titers against L6 at 4 to 6 wk, whereas reactivity to LBD II through IV arose after 6 wk and had maximal values at 9 wk. Thus, linear induction of proteinuria correlated with serum reactivity against LBD fragments, indicative of epitope spreading. By contrast, correlation with anti-L6 reactivity was not significant (Figure 4B). AutoAb eluted from kidneys collected at 12 wk had uniformly high reactivity against LBD fragments and L6 (Figure 5B).

Figure 4.
Figure 4.

Correlation of epitope spreading with disease severity in L6-immunized rats. (A) Disease onset was estimated by quantification of 24-h proteinuria collected at intervals shown from L6-immunized and with complete Freund's adjuvant-immunized control rats. Data are means ± SEM of six rats. (B) Sera collected at 0, 3, 6, and 9 wk from rats immunized with L6 were applied at 1:400 dilution to wells of a microtiter plate coated with recombinant fragments L6, LBD II, LBD III, or LBD IV (1 μg/well). Plates were then washed and developed as described in the Concise Methods section. For each antigen mean ± SEM absorbances were plotted against the corresponding proteinuria values. Linear regression analysis indicated significant correlation for reactivity to LBD II, LBD III, and LBD IV (r2 = 0.930, 0.960, and 0.968; P = 0.035, 0.020, and 0.016, respectively). Binding to L6 did not show significant correlation with proteinuria (r2 = 0.628, P = 0.207).

Figure 5.
Figure 5.

Differences in autoAb spreading in sera and eluates of rats immunized with L6 (▪) and with L3 (□). (A) Sera from 12-wk bleeds were serially diluted and applied to wells of a microtiter plate coated with recombinant fragments L6, LBD II, LBD III, or LBD IV. Plates were then washed and developed as described in the Concise Methods section. (B) Renal eluates of rats immunized with L6 (1:10 diluted) or with L3 (undiluted) were applied to microtiter plates coated with recombinant fragments as described. Data are mean ± SEM absorbances for eluates of three rats in each group.

As reported elsewhere, rats immunized with the smaller N-terminal fragment L3 (residues 1 to 120) also induced high-titer antimegalin autoAb yet developed only mild disease as judged by proteinuria and glomerular complement staining.17 The 12-wk antisera stained all LBD fragments in Western blot (data not shown); however, ELISA titers determined against L6 and LBD fragments were approximately 60 to 80% and 10 to 20%, respectively, of the anti-L6 antisera titers (Figure 5A).

Specificities of autoAb eluted from kidneys of L6- and L3-immunized rats were similarly compared. Eluates from L6-immunized rats at 1:10 dilution bound megalin and LBD II, LBD III, and LBD IV with comparable reactivity. The dominant isotypes included IgG1 and IgG2a, corroborating observations on renal sections17 (data not shown). Binding of eluates from L3-immunized rats to L6 and LBD fragments was undetectable at 1:10 dilution. Reaction of undiluted eluates was three-fold weaker than 10-fold–diluted L6 eluates (Figure 5B).

DISCUSSION

Disease induced with N-terminal megalin fragments was accompanied by antimegalin autoAb in sera and in glomerular ID.16,17 In competition ELISA of antisera induced with a 563-residue fragment, the immunogen did not completely inhibit binding to whole megalin, suggesting that autoAb could react at megalin epitopes outside the N-terminal region.16 In this report, such Ab were observed directly in anti-L6 antisera binding to recombinant fragments LBD II, III, and IV. Two lines of evidence suggested that these autoAb emerge by intramolecular epitope spreading: (1) Reactivity to LBD fragments was delayed by 3 to 4 wk from the primary immune response detected against L6, and (2) soluble L6 failed to inhibit the reaction with LBD fragments on Western blot, whereas native megalin blocked all binding. An immune response to the Hisx6 tag present on each fragment cannot account for cross-reactivity because soluble L6 could be expected to block this binding whereas megalin should not. Immunoblots prepared under reducing SDS-PAGE conditions presumably reveal binding to linear epitopes. Although recombinant proteins were poorly resolved under nonreducing conditions, possibly as a result of intermolecular disulfide linkage, binding to nondenatured LBD antigens could be assessed by ELISA. Thus, comparable titers and relative reactivity of antimegalin and anti-L6 sera determined on these fragments suggested that epitope spreading could lead to relevant autoAb, including those specific for conformational epitopes revealed by ELISA. The concurrent appearance of autoAb reacting with all three LBD fragments indicated that diversification did not require sequential B cell epitope spreading. By contrast, T cell epitope spreading seemed restricted to sequences of LBD IV; however, observation at the single 12-wk time point cannot rule out possible hierarchical spreading to other T cell epitopes, typical of relapsing-remitting autoimmunity. Similarly, the role of the N-terminal fragment or cryptic T cell epitopes of LBD IV in breakdown of tolerance remains to be clarified. Preferential binding to L6 and LBD IV by antisera elicited to whole megalin or to L6 could indicate the presence of immunodominant epitopes linked to proximal T cell epitopes present in these fragments.

Two observations supported a role for epitope spreading in pathogenesis. First, the onset of proteinuria correlated with Ab reactivity to LBD fragments rather than with Ab induced to L6. Second, although epitope spreading was seen in both L6- and L3-immunized rats by Western blot, the anti-LBD serum titers were an order of magnitude weaker in L3-immunized rats, which developed only low proteinuria. Similarly, autoAb eluted from kidneys of L6-immunized rats had more pronounced reactivity to LBD fragments than those of the L3-immunized group. Eluates collected at the 12-wk time point exhibited a narrow range of ELISA reactivity, precluding any meaningful correlation with proteinuria variations within either of these groups.

The potential for IgG deposition to impair glomerular filtration leading to proteinuria is associated with both the size of subepithelial ID and the specificity of autoAb for the membrane-anchored antigen.30 In this context, epitope spreading could enhance polyvalent cross-linkage, forming more stable deposits than those produced by autoAb restricted to epitopes within a small region. This reinforces observations in PHN demonstrating that polyvalent antimegalin Ab induced electron-dense subepithelial deposits.31 By contrast, monovalent antimegalin mAb localized only transiently on podocytes without forming ID.31–33 Multivalent cross-linkage could also enhance complement fixation in the immune complex.

B cell epitope spreading has been implicated in several models of Ab-mediated autoimmune disease.21,34,35 Intramolecular B cell epitope spreading may also present a clinical correlate for pathogenesis in human autoimmune disease.24,25,36 The process may be most relevant to disease when autoAb have a direct role in mediating tissue injury or cytotoxicity, as is the case in AHN; however, it could also have a role in amplifying cell-mediated immunity through unique antigen-processing capacity of B lymphocytes.37,38 In experimental myasthenia gravis, a 210-residue N-terminal fragment of the acetylcholine receptor induced autoAb against C-terminal epitopes of the acetylcholine receptor, including those contained in the cytoplasmic domain.39 In EAG induced with a peptide from the amino-terminal region of α3(IV)NC1, the appearance of autoAb to the whole protein was attributed to epitope spreading.22,27

This study describes a feature of AHN that is shared with other models of organ-specific autoimmune disease. As in experimental myasthenia gravis and EAG, an amino-terminal fragment of the autoantigen can trigger epitope spreading, leading to autoAb and T cells that are capable of tissue-specific pathology. Immune deposition is facilitated by the dense presentation of diverse epitopes on a cell surface macromolecule. Cell-mediated immunity has also been implicated in pathogenesis of AHN.4–6 Renal autoimmune diseases may also recapitulate the role of T cells in amplifying B cell epitope spreading.40 The AHN model described here should prove valuable in further investigations of fundamental mechanisms of autoimmune dysregulation in relation to disease progression.

CONCISE METHODS

Reagents, Proteins, and Rats

Procedures were previously described for preparation of native rat megalin41,42 and for production of rat antimegalin antisera.15 Horseradish peroxidase (HRP)-conjugated goat anti-rat Ab and Con A were obtained from Sigma Chemical Co. (St. Louis, MO). HRP-conjugated anti-Hisx6 mAb was from BD Biosciences (Palo Alto, CA). Protein concentrations were determined by modified Bradford assay (Bio-Rad, Hercules, CA). Female Lewis rats obtained at 6 wk of age from Charles River Laboratories (Wilmington, MA) were cared for and used in accordance with protocols approved by the institutional animal care and use committee.

Cloning and Baculovirus Expression of Megalin Fragments

Production of recombinant L6 (residues 1 to 236) and L3 (residues 1 to 120) was recently reported.17 Fragments LBD II (bp 2982 to 4793, amino acids 929 to 1532), LBD III (bp 7889 to 10103, amino acids 2565 to 3302), and LBD IV (bp 10311 to 12410, amino acids 3372 to 4071) were obtained by PCR amplification of a rat kidney cDNA library (Clontech, Palo Alto, CA) with primers pairs a/b, c/d, and e/f, respectively, as follows:

  1. ATGGATCCGAGCAGCGTAATGCACGTGAAA

  2. TGCTCGAGTTATCCCCTCGGTTTTGTGACATT

  3. ATCCATGGTCAGCACTGCCTTTCATTCCTTTGG

  4. TGCTCGAGTCCCCTGGGATGTTCAAAGCAGA

  5. ATCCATGGAAGGTCACCACCGACACACGGTG

  6. TGCTCGAGCTCGGGATCCCAGTCATAGTCAA.

PCR products were digested with BamHI/XhoI (LBD II) or NcoI/XhoI (LBD III and LBD IV) and cloned in pFastBac HT A, and recombinant baculovirus stocks were prepared using the Bac-to-Bac cloning kit according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). Viral stocks were amplified in Sf21 insect cells, and expression was performed by infection of Trichoplusia Ni (High-Five) cells and harvest of cells after 4 d.

Purification and MS Analysis of Recombinant Proteins

Cells were lysed in 10 mM Tris (pH 7.6) containing 1% Triton X100 containing protease inhibitors and were centrifuged (10,000 rpm, 20 min). Supernatants were reduced with 2-mercaptoethanol (5 mM) and purified on NiNTA resin according to the manufacturer's instructions (EMD Biosciences, San Diego, CA). Protein separated by SDS-PAGE was stain by Coomassie, and gel slices were excised, washed in ammonium bicarbonate buffer, reduced (dithiothreitol) and alkylated (iodoacetamide), then digested with sequencing-grade trypsin (Promega, Madison, WI). Eluted peptides were analyzed by matrix-assisted laser desorption ionization MS/MS on an Applied Biosystems (Foster City, CA) 4700 mass spectrometer operated by the University of California, Davis, proteomics facility.

Induction of AHN and Collection of Sera and Renal Eluates

Rats were immunized by intradermal injection at several dorsal sites with recombinant L6 or L3 as previously reported.17 Urine was collected at 3-wk intervals from rats housed in metabolic cages with free access to water. Total proteinuria was determined by the sulfosalicylic acid method as described previously.42 Rats were bled from the tail artery at 3, 6, 9, and 12 wk after immunization. Antisera from previous immunizations were collected at 4, 8, and 12 wk. Eluates were prepared as described previously43 from two kidneys collected at week 12 and diluted to a standard volume for immunoassay comparison.

ELISA and Immunoblot Analysis

Recombinant proteins resolved by SDS-PAGE were stained with Coomassie blue or transferred to Immobilon-P (Millipore, Billerica, MA) for 3 h, 75 V at 4°C. After blocking in Tris-buffered saline [TBS] and 3% non-fat dry milk (NFM), membranes were incubated with rat antimegalin antisera (1:5000 in TBS, 3% NFM, and 0.05% Tween) for 2 h at 4°C. Blots were washed, incubated with goat anti-rat HRP (Southern Biotechnologies, Birmingham, AL) at 1:10,000 dilution in TBS-Tween, and developed with ECL substrates (Amersham Biosciences, Piscataway, NJ). For tag detection, membranes were blocked as described and incubated with anti-Hisx6 mAb-HRP diluted 1:10,000 in TBS-Tween. ELISA plates were coated with rat megalin (0.1 μg/well) or megalin fragment L6, LBD II, LBD III, or LBD IV (0.5 μg/well) in TBS (pH 7.6) for 2 h at 23°C and blocked with 3% NFM in PBS. Antisera were serially diluted in PBS-Tween and applied for 1 h at room temperature. Plates were washed three times with the PBS-Tween, and goat anti-rat HRP (1:10,000 in PBS-Tween) was added for 1 h. Plates were then washed as described and developed with tetramethylbenzidine substrate (Pierce Biotechnology, Rockford, IL). Absorbances at 650 nm were corrected for background, and titers were estimated from the half-maximal values. For time course correlation and intergroup comparisons, absorbances at fixed dilution of serum (1:400) or renal eluates (1:10 or undiluted) were used after correction for background absorbance of normal serum or eluate, respectively.

LNC Proliferation Assay

Lymph nodes (popliteal and axillary) were collected at 12 wk from rats immunized with L6 as described previously. Single-cell suspensions in RPMI-1640 2% normal Lewis rat serum, 50 μM 2-mercaptoethanol, 100 U penicillin, and 100 μg/ml streptomycin were dispensed at 5 × 106 cells/well. Proteins or Con A (5 μg/ml) in sterile PBS or PBS alone (background) were added in triplicate wells. After 72 h at 37°C in a CO2 incubator, cells were pulsed for 18 h with 0.5 μCi/well 3H-thymidine (Amersham Biosciences). Cells were harvested on filter plates, washed, and counted on a TopCount plate reader (Perkin Elmer Instruments, Shelton, CT). Proliferation was expressed as total counts (antigen) − background counts (PBS). Values represent means ± SEM of triplicate wells.

DISCLOSURES

None.

Acknowledgments

This work was supported by National Institutes of Health grants DK33941 (to SPM) and CA90564 (to AT), the American Diabetes Association (to AT), and the Children's Miracle Network, University of California Davis Medical Center.

This work was presented in abstract form at the sixth annual meeting of the Federation of Clinical Immunology Societies; June 1 through 5, 2006; San Francisco, CA.

We thank Romina Sacchi and Nadezda Sinitsyna for excellent technical assistance.

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

REFERENCES

  1. ↵
    Raychowdhury R, Niles JL, McCluskey RT, Smith JA: Autoimmune target in Heymann nephritis is a glycoprotein with homology to the LDL receptor. Science 244 : 1163 –1165, 1989
    OpenUrlAbstract/FREE Full Text
  2. ↵
    Kerjaschki D, Miettinen A, Farquhar MG: Initial events in the formation of immune deposits in passive Heymann nephritis: gp330-anti-gp330 immune complexes form in epithelial coated pits and rapidly become attached to the glomerular basement membrane. J Exp Med 166 : 109 –128, 1987
    OpenUrlAbstract/FREE Full Text
  3. ↵
    Kanalas JJ, Makker SP: Isolation of a 330-kDa glycoprotein from human kidney similar to the Heymann nephritis autoantigen (gp330). J Am Soc Nephrol 1 : 792 –798, 1990
    OpenUrlAbstract
  4. ↵
    Quiza CG, Leenaerts PL, Hall BM: The role of T cells in the mediation of glomerular injury in Heymann's nephritis in the rat. Int Immunol 4 : 423 –432, 1992
    OpenUrlCrossRefPubMed
  5. Penny MJ, Boyd RA, Hall BM: Role of T cells in the mediation of Heymann nephritis: II—Identification of Th1 and cytotoxic cells in glomeruli. Kidney Int 51 : 1059 –1068, 1997
    OpenUrlCrossRefPubMed
  6. ↵
    Walters G, Wu H, Knight JF: Glomerular T cells in Heymann nephritis. Clin Exp Immunol 126 : 319 –325, 2001
    OpenUrlCrossRefPubMed
  7. ↵
    Debiec H, Nauta J, Coulet F, van der Burg M, Guigonis V, Schurmans T, de Heer E, Soubrier F, Janssen F, Ronco P: Role of truncating mutations in MME gene in fetomaternal alloimmunisation and antenatal glomerulopathies. Lancet 364 : 1252 –1259, 2004
    OpenUrlCrossRefPubMed
  8. ↵
    Argraves WS: Members of the low density lipoprotein receptor family control diverse physiological processes. Front Biosci 6 : D406 –D416, 2001
    OpenUrlCrossRefPubMed
  9. Orlando RA, Exner M, Czekay RP, Yamazaki H, Saito A, Ullrich R, Kerjaschki D, Farquhar MG: Identification of the second cluster of ligand-binding repeats in megalin as a site for receptor-ligand interactions. Proc Natl Acad Sci U S A 94 : 2368 –2373, 1997
    OpenUrlAbstract/FREE Full Text
  10. ↵
    Christensen EI, Birn H: Megalin and cubilin: multifunctional endocytic receptors. Nat Rev Mol Cell Biol 3 : 256 –266, 2002
    OpenUrlCrossRefPubMed
  11. ↵
    Saito A, Yamazaki H, Rader K, Nakatani A, Ullrich R, Kerjaschki D, Orlando RA, Farquhar MG: Mapping rat megalin: The second cluster of ligand binding repeats contains a 46-amino acid pathogenic epitope involved in the formation of immune deposits in Heymann nephritis. Proc Natl Acad Sci U S A 93 : 8601 –8605, 1996
    OpenUrlAbstract/FREE Full Text
  12. ↵
    Kerjaschki D, Exner M, Ullrich R, Susani M, Curtiss LK, Witztum JL, Farquhar MG, Orlando RA: Pathogenic antibodies inhibit the binding of apolipoproteins to megalin/gp330 in passive Heymann nephritis. J Clin Invest 100 : 2303 –2309, 1997
    OpenUrlCrossRefPubMed
  13. ↵
    Raychowdhury R, Zheng G, Brown D, McCluskey RT: Induction of Heymann nephritis with a gp330/megalin fusion protein. Am J Pathol 148 : 1613 –1623, 1996
    OpenUrlPubMed
  14. ↵
    Yamazaki H, Ullrich R, Exner M, Saito A, Orlando RA, Kerjaschki D, Farquhar MG: All four putative ligand-binding domains in megalin contain pathogenic epitopes capable of inducing passive Heymann nephritis. J Am Soc Nephrol 9 : 1638 –1644, 1998
    OpenUrlAbstract
  15. ↵
    Oleinikov AV, Feliz BJ, Makker SP: A small N-terminal 60-kD fragment of gp600 (megalin), the major autoantigen of active Heymann nephritis, can induce a full-blown disease. J Am Soc Nephrol 11 : 57 –64, 2000
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Tramontano A, Makker SP: Conformation and glycosylation of a megalin fragment correlate with nephritogenicity in Heymann nephritis. J Immunol 172 : 2367 –2373, 2004
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Tramontano A, Knight T, Vizzuso D, Makker SP: Nested N-terminal megalin fragments induce high-titer autoantibody and attenuated Heymann nephritis. J Am Soc Nephrol 17 : 1979 –1985, 2006
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Scofield RH, Pierce PG, James JA, Kaufman KM, Kurien BT: Immunization with peptides from 60 kDa Ro in diverse mouse strains. Scand J Immunol 56 : 477 –483, 2002
    OpenUrlCrossRefPubMed
  19. Deshmukh US, Kannapell CC, Fu SM: Immune responses to small nuclear ribonucleoproteins: Antigen-dependent distinct B cell epitope spreading patterns in mice immunized with recombinant polypeptides of small nuclear ribonucleoproteins. J Immunol 168 : 5326 –5332, 2002
    OpenUrlAbstract/FREE Full Text
  20. ↵
    McCluskey J, Farris AD, Keech CL, Purcell AW, Rischmueller M, Kinoshita G, Reynolds P, Gordon TP: Determinant spreading: Lessons from animal models and human disease. Immunol Rev 164 : 209 –229, 1998
    OpenUrlCrossRefPubMed
  21. ↵
    Thrasyvoulides A, Lymberi P: Evidence for intramolecular B-cell epitope spreading during experimental immunization with an immunogenic thyroglobulin peptide. Clin Exp Immunol 132 : 401 –407, 2003
    OpenUrlCrossRefPubMed
  22. ↵
    Bolton WK, Chen L, Hellmark T, Wieslander J, Fox JW: Epitope spreading and autoimmune glomerulonephritis in rats induced by a T cell epitope of Goodpasture's antigen. J Am Soc Nephrol 16 : 2657 –2666, 2005
    OpenUrlAbstract/FREE Full Text
  23. ↵
    Krebs P, Kurrer MO, Kremer M, De Giuli R, Sonderegger I, Henke A, Maier R, Ludewig B: Molecular mapping of autoimmune B cell responses in experimental myocarditis. J Autoimmun 28 : 224 –233, 2007
    OpenUrlCrossRefPubMed
  24. ↵
    Li N, Aoki V, Hans-Filho G, Rivitti EA, Diaz LA: The role of intramolecular epitope spreading in the pathogenesis of endemic pemphigus foliaceus (fogo selvagem). J Exp Med 197 : 1501 –1510, 2003
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Ueki A, Isozaki Y, Tomokuni A, Hatayama T, Ueki H, Kusaka M, Shiwa M, Arikuni H, Takeshita T, Morimoto K: Intramolecular epitope spreading among anti-caspase-8 autoantibodies in patients with silicosis, systemic sclerosis and systemic lupus erythematosus, as well as in healthy individuals. Clin Exp Immunol 129 : 556 –561, 2002
    OpenUrlCrossRefPubMed
  26. ↵
    Salato VK, Hacker-Foegen MK, Lazarova Z, Fairley JA, Lin MS: Role of intramolecular epitope spreading in pemphigus vulgaris. Clin Immunol 116 : 54 –64, 2005
    OpenUrlCrossRefPubMed
  27. ↵
    Wu J, Arends J, Borillo J, Zhou C, Merszei J, McMahon J, Lou YH: A self T cell epitope induces autoantibody response: mechanism for production of antibodies to diverse glomerular basement membrane antigens. J Immunol 172 : 4567 –4574, 2004
    OpenUrlAbstract/FREE Full Text
  28. ↵
    Dean EG, Wilson GR, Li M, Edgtton KL, O'Sullivan KM, Hudson BG, Holdsworth SR, Kitching AR: Experimental autoimmune Goodpasture's disease: A pathogenetic role for both effector cells and antibody in injury. Kidney Int 67 : 566 –575, 2005
    OpenUrlCrossRefPubMed
  29. ↵
    Wu J, Hicks J, Ou C, Singleton D, Borillo J, Lou YH: Glomerulonephritis induced by recombinant collagen IV alpha 3 chain noncollagen domain 1 is not associated with glomerular basement membrane antibody: A potential T cell-mediated mechanism. J Immunol 167 : 2388 –2395, 2001
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Makker SP, Tramontano A: Differential capacity of anti-RAP and anti-megalin antibodies to produce progressive passive Heymann nephritis: Implications for the pathogenesis of idiopathic human membranous glomerulonephritis. J Pathol 210 : 282 –287, 2006
    OpenUrlCrossRefPubMed
  31. ↵
    Allegri L, Brianti E, Chatelet F, Manara GC, Ronco P, Verroust P: Polyvalent antigen-antibody interactions are required for the formation of electron-dense immune deposits in passive Heymann's nephritis. Am J Pathol 125 : 1 –6, 1986
    OpenUrlPubMed
  32. Bhan AK, Schneeberger EE, Baird LG, Collins AB, Kamata K, Bradford D, Erikson ME, McCluskey RT: Studies with monoclonal antibodies against brush border antigens in Heymann nephritis. Lab Invest 53 : 421 –432, 1985
    OpenUrlPubMed
  33. ↵
    Dekan G, Miettinen A, Schnabel E, Farquhar MG: Binding of monoclonal antibodies to glomerular endothelium, slit membranes, and epithelium after in vivo injection: Localization of antigens and bound IgGs by immunoelectron microscopy. Am J Pathol 137 : 913 –927, 1990
    OpenUrlPubMed
  34. ↵
    James JA, Gross T, Scofield RH, Harley JB: Immunoglobulin epitope spreading and autoimmune disease after peptide immunization: Sm B/B′-derived PPPGMRPP and PPPGIRGP induce spliceosome autoimmunity. J Exp Med 181 : 453 –461, 1995
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Monneaux F, Muller S: Epitope spreading in systemic lupus erythematosus: Identification of triggering peptide sequences. Arthritis Rheum 46 : 1430 –1438, 2002
    OpenUrlCrossRefPubMed
  36. ↵
    Schlosser M, Banga JP, Madec AM, Binder KA, Strebelow M, Rjasanowski I, Wassmuth R, Gilliam LK, Luo D, Hampe CS: Dynamic changes of GAD65 autoantibody epitope specificities in individuals at risk of developing type 1 diabetes. Diabetologia 48 : 922 –930, 2005
    OpenUrlCrossRefPubMed
  37. ↵
    Jaume JC, Parry SL, Madec AM, Sonderstrup G, Baekkeskov S: Suppressive effect of glutamic acid decarboxylase 65-specific autoimmune B lymphocytes on processing of T cell determinants located within the antibody epitope. J Immunol 169 : 665 –672, 2002
    OpenUrlAbstract/FREE Full Text
  38. ↵
    Mamula MJ: Epitope spreading: The role of self peptides and autoantigen processing by B lymphocytes. Immunol Rev 164 : 231 –239, 1998
    OpenUrlCrossRefPubMed
  39. ↵
    Feferman T, Im SH, Fuchs S, Souroujon MC: Breakage of tolerance to hidden cytoplasmic epitopes of the acetylcholine receptor in experimental autoimmune myasthenia gravis. J Neuroimmunol 140 : 153 –158, 2003
    OpenUrlCrossRefPubMed
  40. ↵
    Robertson J, Wu J, Arends J, Zhou C, McMahon J, Torres L, Lou YH: Activation of glomerular basement membrane-specific B cells in the renal draining lymph node after T cell-mediated glomerular injury. J Am Soc Nephrol 16 : 3256 –3263, 2005
    OpenUrlAbstract/FREE Full Text
  41. ↵
    Kanalas JJ, Makker SP: A possible ligand of serum origin for the kidney autoantigen of Heymann nephritis. J Immunol 141 : 4152 –4157, 1988
    OpenUrlAbstract
  42. ↵
    Makker SP, Singh AK: Characterization of the antigen (gp600) of Heymann nephritis. Lab Invest 50 : 287 –293, 1984
    OpenUrlPubMed
  43. ↵
    Makker SP: Analysis of glomeruli-eluted Gp330 autoantibodies and of Gp330 antigen of Heymann nephritis. J Immunol 151 : 6500 –6508, 1993
    OpenUrlAbstract
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Intramolecular Epitope Spreading in Heymann Nephritis
Pallavi Shah, Alfonso Tramontano, Sudesh P. Makker
JASN Dec 2007, 18 (12) 3060-3066; DOI: 10.1681/ASN.2007030342
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo

Jump to section