BASIC RESEARCH

Maintenance of Tolerance by Regulation of Anti-myeloperoxidase B Cells

Donna O. Bunch, Jonathan S. Silver, Melanie C. Majure, Pamela Sullivan, David A. Alcorta, Hyunsook Chin, Susan L. Hogan, Yoshi I. Lindstrom, Stephen H. Clarke, Ronald J. Falk and Patrick H. Nachman
JASN September 2008, 19 (9) 1763-1773; DOI: https://doi.org/10.1681/ASN.2007030382

Abstract

Anti-neutrophil cytoplasmic autoantibodies directed toward myeloperoxidase or proteinase 3 are detected in sera of patients with small vessel vasculitis and participate in the pathogenesis of this disease. Autoantibodies develop when self-reactive B cells escape the regulation that ensures self-tolerance. In this study, regulation of anti-myeloperoxidase B cells was examined in mice that express an anti-myeloperoxidase Vκ1C-Jκ5 light-chain transgene, which confers anti-myeloperoxidase specificity when combined with a variety of heavy chains. Vκ1C-Jκ5 transgenic mice have splenic anti-myeloperoxidase B cells but do not produce circulating anti-myeloperoxidase antibodies. Two groups of transgenic mice that differed by their relative dosage of the transgene were compared; high-copy mice had a mean relative transgene dosage of 1.92 compared with 1.02 in the low-copy mice. These mice exhibited a 90 and 60% decrease in mature follicular B cells, respectively. High-copy mice were characterized by a large population of anti-myeloperoxidase B cells, a preponderance of B-1 cells, and an increased percentage of apoptotic myeloperoxidase-binding B cells. Low-copy mice had similar changes in B cell phenotype with the exception of an expanded marginal zone population. B cells from low-copy mice but not high-copy mice produced anti-myeloperoxidase antibodies after stimulation with lipopolysaccharide. These results indicate that tolerance to myeloperoxidase is maintained by central and peripheral deletion and that some myeloperoxidase-binding B cells are positively selected into the marginal zone and B-1 B cell subsets. A defect in these regulatory pathways could result in autoimmune disease.

Anti-neutrophil cytoplasmic autoantibodies (ANCA), directed against myeloperoxidase (MPO) and proteinase 3 (PR3), are detected in 90% of patients with small vessel vasculitis, including Wegener's granulomatosis, microscopic polyangiitis, and pauci-immune necrotizing crescentic glomerulonephritis.1,2 Many in vitro2,3 and in vivo studies4–8 demonstrated that ANCA participate in the pathogenesis of small vessel vasculitis. Less work has focused on understanding the immunopathogenesis of the ANCA autoimmune response. Previous studies suggested that the human MPO-ANCA response is highly restricted.9 To investigate this response further, we used an anti-MPO antibody derived from SCG/Kj mice, a recombinant inbred strain that spontaneously develops vasculitis and crescentic glomerulonephritis.

Although SCG/Kj mice may not be a good model for pauci-immune glomerulonephritis, 30% of these mice spontaneously develop anti-MPO antibodies.10,11 These anti-MPO antibodies are useful in studying the derivation of this autoimmune response. Previously, we demonstrated a restriction in Vκ gene use in anti-MPO–producing hybridomas derived from SCG/Kj mice.12 This restriction suggests an important role of the Ig light chain in determining specificity to MPO.

The aims of this study were to determine the role of the Ig light chain in determining specificity of anti-MPO antibodies and the mechanism of anti-MPO B cell regulation in a nonautoimmune animal model. Using mice transgenic (Tg) for the Vκ1C-Jκ5 light chain derived from an anti-MPO hybridoma from SCG/Kj mice, we investigated several questions. Does expression of the Vκ1C-Jκ5 light chain lead to the generation of anti-MPO B cells? Do anti-MPO B cells produce circulating anti-MPO antibodies? If not, then at which point in their maturation are the B cells regulated to maintain a state of immune tolerance to MPO? The answers to these questions will contribute to our understanding of how tolerance is maintained in normal individuals and how a breakdown in these mechanisms can lead to the generation of anti-MPO antibodies and autoimmune disease.

RESULTS

Vκ1C-Jκ5 Light-Chain Tg Mice

To study the regulation of anti-MPO B cells, we generated mice transgenic for the rearranged Vκ1C-Jκ5 gene derived from an anti-MPO hybridoma (Figure 1A).12 Interbreeding produced two groups of Vκ1C-Jκ5 Tg mice that differed in their relative number of copies of the transgene (Figure 1B). Mice with the larger number of transgene copies are referred to as “high copy” (HC) mice and the other group as “low copy” (LC) mice. Quantitative PCR analysis revealed that HC Tg mice had a mean 2(−DDct) of 1.92 ± 0.7 of measured transgene in their genomic DNA compared with the LC Tg mice mean 2(−DDct) of 1.02 ± 0.2 (P = 0.0018).

Figure 1.
Figure 1.

MPO-binding B cells are found in spleens of Tg mice. (A) Diagram of the transgene construct. Locations of the endogenous Vκ21C promoter (P), Vκ21C leader sequence (L), rearranged Vκ1C/Jκ5 light chain (VκJκ), Cκ enhancer (E), and Cκ secretory exons (Cκ) are indicated. The EcoRI (RI) and XbaI (X) restriction sites used for subcloning are depicted. (B) Tg mice express the Vκ1C/Jκ5 light-chain transgene. Shown are PCR products from 1 ng of DNA from non-Tg control mice, LC mice, and HC mice. Both groups of Tg mice yield the Tg PCR product; non-Tg controls are negative. For identification of MPO-binding cells by FACS analysis, splenic cells were incubated with biotinylated MPO followed by streptavidin-peridinin chlorophyll protein. Cells positive for IgM and/or B220 were defined as B cells. (C) Representative histograms of a C57Bl/6 wild-type control mouse, a non-Tg littermate control mouse, an LC Tg mouse, and an HC Tg mouse that demonstrate the paucity of MPO-binding B cells in control mice compared with LC Tg mice and the distinct population of MPO binders found in HC Tg mice. (D) Percentage of MPO-binding splenic B cells is summarized. In contrast to the low level of MPO-binding B cells found in controls (n = 13), LC mice (n = 7) have significantly larger populations of MPO-binding B cells (P < 0.0001), and many of the HC mice (n = 14) have robust populations of MPO-binding B cells.

Tg Mice Have MPO-Binding B Cells but no Circulating Anti-MPO Antibodies

To test whether the Vκ1C-Jκ5 light-chain transgene was sufficient to produce anti-MPO B cells, we searched for MPO-binding cells by FACS analysis. Splenocytes of LC (3.0 ± 0.7%) and HC mice (9.7 ± 8.1%) had a significantly increased percentage of MPO-binding B cells when compared with control mice (1.5 ± 0.6%; P < 0.0001; Figure 1, C and 1D). Likewise, the percentage of MPO-binding B cells in the bone marrow of LC and HC mice (6.3 ± 2.3 and 13.7 ± 4.8%, respectively) was significantly greater than in controls (2.1 ± 0.9%; P < 0.0001; Table 1). In contrast, no PR3-binding B cells could be detected in Tg mice, indicating that binding of MPO is specific. Despite the documented presence of anti-MPO B cells, no Tg mice were found to have circulating anti-MPO antibodies as determined by ELISA against either native human MPO or recombinant mouse MPO when compared with non-Tg mice.

View this table:
Table 1.

Comparison of B cell populations in LC Tg and HC Tg mice to non-Tg control micea

Vκ1C-Jκ5 Splenocytes Can Produce Anti-MPO Antibodies

To verify that the Tg Vκ1C/Jκ5 light chain participates in the production of secreted anti-MPO antibodies, we generated 20 anti-MPO hybridomas from four LC Tg mice. Isotype analysis indicated antibodies produced were IgM/κ. Specificity to MPO was demonstrated by lack of binding to DNA and PR3 by ELISA. Generation of these hybridomas confirms the presence of functional splenic anti-MPO B cells in Vκ1C/Jκ5 Tg mice.

To verify expression of the Vκ1C/Jκ5 light-chain transgene and determine whether the Tg light chain conferred allelic exclusion, we analyzed seven anti-MPO hybridomas by 5′ RACE using primers in the Cκ region. Sequencing revealed that the light-chain transgene alone was expressed in four of seven hybridomas examined (Table 2). Two hybridomas expressed Vκ12-41 in addition to the Vκ1C Tg, and one hybridoma expressed Vκ21-4 alone (Table 2), indicating that the transgene had not conferred allelic exclusion in all cells. We also determined that four different heavy chains paired with the Vκ1C/Jκ5 light-chain transgene to create anti-MPO antibodies (Table 2) in addition to the VH 3609 heavy chain expressed by the original anti-MPO hybridoma (Table 2). These results demonstrate that the Vκ1C/Jκ5 light chain can confer anti-MPO specificity when combined with a variety of heavy chains.

View this table:
Table 2.

Vκ1C/Jκ5 Light Chain Transgenic Hybridoma Sequences

For determination of whether anti-MPO splenocytes were anergic, total splenocytes and B cells were cultured in the presence or absence of MPO, LPS, or anti-IgM. Anti-MPO antibodies were produced in splenocytes and B cells from LC Tg but not HC Tg stimulated with LPS (Supplemental Figure 1). Likewise, MPO-binding B cells from LC Tg but not HC Tg proliferated after LPS stimulation as measured by carboxyfluorescein diacetate, succinimidyl ester (Supplemental Figure 2). These data indicate that anti-MPO B cells in LC Tg mice are not anergic. In contrast, our data would be consistent with anergy of anti-MPO B cells from HC Tg mice.

Bone Marrow and Splenic B Cells Are Decreased in Vκ1C-Jκ5 Tg Mice

To investigate why expression of the Vκ1C/Jκ5 light chain produced anti-MPO B cells but not circulating anti-MPO antibodies, we looked for alterations in B cell differentiation. In the bone marrow, the percentage of B220+ B cells was markedly reduced in both LC (11.8 ± 3.5%) and HC Tg mice (7.8 ± 8.7%) compared with control mice (50.2 ± 19.8%; P = 0.0002; Table 1), corresponding to a decrease in the total number of B220+ B cells of 85 and 93%, respectively. To determine whether B cell development was altered in the bone marrow, pro-/pre-B cells, immature B cells, and recirculating mature B cells were distinguished by staining with B220 and IgM. The number of IgM+/B220hi recirculating B cells was reduced by 70% in LC mice and 95% in HC mice (Table 1). Similarly, the number of pro-/pre-B cells was decreased by 90% in HC mice and by 60% in LC mice. The number of IgM+/B220+ immature B cells was reduced by 66% in LC mice and 79% in HC mice (Table 1). The ratio of pro-/pre-B cells to immature B cells is not higher in LC or HC Tg (4.6:1 and 2.6:1, respectively) compared with control mice (6.4:1), suggesting that there is no block in development of pro-/pre-B cells to immature B cells in Tg mice.

In the spleen, the percentage of total IgM+ and/or B220+ splenic B cells was decreased significantly in both LC (48.1 ± 9.9%) and HC (22.4 ± 17.9%) Tg mice compared with control mice (65.6 ± 7.1%; P ≤ 0.0001). Similarly, the absolute number of splenic B cells is reduced by 30% in LC mice and 60% in HC mice. In the peritoneal cavity, we found no significant differences in the absolute number or the percentage of IgM+ B cells in Tg as compared with control mice (Table 1).

Tg Mice Exhibit a Decrease in Mature Follicular Cells

Tg mice demonstrated altered splenic B cell subpopulations when compared with non-Tg mice. Antibodies to CD23, CD21, and IgM were used to distinguish mature follicular (IgM+CD21+CD23+) and marginal zone (IgM+CD21+CD23−) B cells. Cells that are IgM+CD21−CD23− could be either B-1 or transitional 1 (T1) B cells and are referred to as T1/B1 cells.13 Representative CD21/CD23 histograms are presented in Figure 2. LC mice had increased percentages of marginal zone and T1/B-1 cells and a decreased percentage of mature follicular cells (Figure 2C). In HC mice, the majority of B cells were T1/B-1 with few marginal zone or follicular cells (Figure 2D). Differences among the three groups are summarized in Figure 2E. Compared with controls (73.6 ± 7.7%), LC mice had a 70% (23.1 ± 9.0%; P < 0.0001) and HC mice a 93% (5.2 ± 4.4%; P < 0.0001) decrease in the percentage of mature splenic follicular cells. LC mice had an increased percentage of marginal zone (39.5 ± 10.2%; P < 0.0001; confirmed by staining with an antibody to the marginal zone–specific marker CD9) and T1/B-1 B cells (31.5 ± 13.4%; P < 0.0001). HC mice had a preponderance of T1/B-1 B cells (79.1 ± 16.7%) greater than that found in either LC or control mice (P < 0.0001); however, the percentage of marginal zone cells was no different from controls. When absolute cell numbers were considered, these alterations in splenic follicular and marginal zone B cell subpopulations were confirmed (Table 1).

Figure 2.
Figure 2.

Percentages of follicular, marginal zone, and T1/B-1 cells are altered in Vκ1C/Jκ5 Tg mice. (A through D) Representative CD21/CD23 histograms for a C57BL/6 wild-type control (A), a non-Tg littermate control (B), an LC mouse (C), and an HC mouse (D). The majority of B cells in control mice are mature follicular cells. LC mice have increased percentages of marginal zone and T1/B-1 cells, which parallel a decrease in the percentage of mature follicular cells. In HC mice, the majority of cells are T1/B-1 with few marginal zone or follicular cells. (E) The percentages of follicular, marginal zone, or T1/B-1 cells based on CD21/CD23 staining of splenic B cells from each type of mice are summarized. LC mice consistently have higher percentages of marginal zone and T1/B-1, whereas HC mice have mostly T1/B-1 cells.

To distinguish B-1 cells from T1 cells, we analyzed splenic B cells with antibodies to CD5 and CD43. The majority of cells classified as T1/B-1 on the basis of CD21/CD23 staining were in fact B-1 cells. The percentages of CD5+/CD43+ B-1 cells increased in LC mice (25.4 ± 11.2%; Figure 3, C and E) and in HC mice (50.6 ± 21.5%; Figure 3, D and E) compared with control mice (7.5 ± 4.3%; P < 0.0001; Figure 3, A, B, and E). Although we noted a trend toward increased numbers of B-1 cells in LC and HC mice, the absolute number of B-1 cells did not differ significantly. We observed no statistically significant differences in either the number or the percentage of B-1 cells in the peritoneal cavity of Tg mice compared with control mice (Table 1).

Figure 3.
Figure 3.

Vκ1C/Jκ5 Tg mice have an increased percentage of B-1 cells. (A through D) Representative CD5/CD43 histograms for a B6 wild-type control (A), a non-Tg littermate control (B), an LC mouse (C), and an HC mouse (D). Percentages of B-1 cells are given in the corner of each histogram. Wild-type and non-Tg control mice have normal percentages of B-1 cells. The LC mice have a slight increase in the percentage of B-1 cells, whereas a dramatic increase in B-1 cells is observed in the HC mice. (E) Shown is a summary of the percentages of splenic B cells classified as B-1 (CD5+/CD43+) for mice in each group. Both LC and HC mice have increased percentages of B-1 cells compared with non-Tg control mice.

MPO-Binding Cells Are Marginal Zone and B-1 B Cells

We observed a significant percentage of MPO-binding B cells in spleens of Tg mice. Although MPO-binding splenic B cells are rare in non-Tg control mice, half of these MPO binders have a follicular cell phenotype (Table 1), whereas the percentage of MPO binders that progress to the follicular stage is reduced in both LC and HC Tg mice (18.1 ± 10.1 and 21.0 ± 16.9%, respectively; P < 0.0001). Most MPO-binding B cells are B-1 cells in both LC (51.8 ± 15.1%) and HC mice (66.1 ± 18.1%) compared with control mice (38.9 ± 12.5%; P ≤ 0.002; Figure 4). Both the percentage (36.2 ± 15.6%; P < 0.0001) and absolute number (48.0 ± 57.4 × 104; P ≤ 0.002) of MPO-binding cells that are marginal zone cells in LC mice are significantly elevated when compared with non-Tg and HC Tg mice. Control and HC mice have a similar percentage and number of MPO-binding marginal zone cells (Table 1).

Figure 4.
Figure 4.

MPO-binding B cells are increased in immature bone marrow cells of Vκ1C/Jκ5 Tg mice and T1/B1 cells in the spleen. (A, D, and G) Representative histograms for a non-Tg control (A), LC Tg mouse (D), and HC Tg mouse (G) depicting the proportion of pro-/pre-B (B220lo/IgMneg), immature B (B220lo/IgM+), and recirculating B (B220hi/IgM+) cells in the bone marrow. (B, E, and H) Histograms gated on R5 immature B cells show the percentage of B220lo MPO-binding B cells for a non-Tg control (B), an LC mouse (E), and an HC mouse (H). The percentage of immature MPO-binding B cells is increased in Tg mice. (C, F, and I) Representative histograms gated on IgM+/MPO+ cells show the percentage of MPO-binding follicular (CD21int/CD23+), marginal zone (CD21+/CD23neg), and T1/B-1 (CD21lo/CD23neg) for a non-Tg (C), an LC (F) and an HC (I) mouse.

Apoptotic MPO-Binding B Cells Are Increased in Tg Mice

We found a significant decrease in the number of recirculating B cells in the bone marrow and follicular B cells in the spleen of Tg mice. To investigate the loss of these mature B cells, we gated on the apoptotic cell population based on forward and side scatter and found that >95% of the MPO-binding B cells (shown in blue) in the bone marrow are apoptotic as confirmed by staining with FITC-conjugated VAD-FMK (Figure 5, A through F). Furthermore, we observed a striking increase in the percentage of apoptotic MPO-binding B cells (shown in blue) in the spleen (Figure 5, G through O) in Tg mice (LC = 29.9 ± 10.2%; HC = 52.5 ± 15.1%) as compared with controls (14.4 ± 4.8%; P < 0.0001; Table 1). Essentially 100% of the VAD-FMK–positive MPO-binding B cells also stained positive with FAM-LETD-FMK, which binds activated caspase 8 (data not shown), suggesting that apoptosis of MPO-binding B cells is triggered by death receptor activation of the extrinsic pathway of apoptosis. The ratio of T1 to follicular B cells in HC (16.8:1) and LC (0.32:1) Tg mice compared with non-Tg mice (0.06:1) indicates that deletion occurs at the T1 to follicular B cell transition.

Figure 5.
Figure 5.

Apoptotic MPO-binding B cells are increased in Vκ1C/Jκ5 Tg mice. Representative histograms of cells from the bone marrow of a non-Tg (A through C) and an HC Tg (D through F) are presented. A white oval depicts the population based on forward versus side scatter that is considered apoptotic (A and D). Histograms in B and E confirm that the cells in the apoptotic gate based on forward versus side scatter are VAD-FMK+. Histograms in C and F demonstrate that 96 and 98% of the B220+/IgM+ MPO-binding B cells (shown in blue) in the apoptotic gate of non-Tg (C) and HC Tg (F) mice are VAD-FMK+. (G, J, and M) Representative forward and side scatter histograms for splenocytes from a B6 wild-type control (G), an LC Tg mouse (J), and an HC Tg mouse (M) are shown. The region referred to as the apoptotic cell gate is indicated by a white oval. The apoptotic status of cells in the apoptotic cell gate was confirmed by staining with VAD-FMK. IgM/VAD-FMK histograms for B220+ cells from the apoptotic gate are shown for a B6 wild-type control (H and I), an LC mouse (K and L), and an HC mouse (N and O). A majority of B cells in the apoptotic cell gate are VAD-FMK+ as depicted in H, K, and N; percentages shown are VAD-FMK+ cells. MPO binders (shown in blue in I, L, and O) are apoptotic and are found in greater abundance in Tg mice; percentages given are VAD-FMK+ MPO binders. Data demonstrating that MPO-binding B cells in the spleen are increased in the apoptotic cell gate is summarized in P. Shown are the percentages of MPO-binding B cells in the black oval normal lymphocyte gate (♦) and in the white oval apoptotic cell gate (▪) for each group of mice. Although there are more MPO binders in the apoptotic cell gate than in the normal lymphocyte gate in each group, the increased population of apoptotic cells that bind MPO is striking in LC mice (44.9%) and in HC mice (62.5%).

DISCUSSION

The purpose of this work was to elucidate the regulation of the anti-MPO response in nonautoimmune mice and to assess the ability of the antibody light chain to confer specificity to MPO. To this end, we used a Vκ1C-Jκ5 anti-MPO light chain derived from an anti-MPO hybridoma generated from SCG/Kj mice10 to produce Tg mice. We identified two groups of Tg mice that exhibit altered B cell phenotypes compared with non-Tg controls. The phenotypic differences in LC and HC mice correlated with a doubling of the relative transgene copy number in the HC mice. It is possible that the observed differences in phenotype could result from a “transgene effect” that alters another gene as a result of the site of insertion; however, we believe that this is unlikely. The B cell phenotype of mice from three additional founder lines also correlated with relative transgene copy number (data not shown). We detected anti-MPO B cells in both groups of Tg mice; however, none expressed circulating anti-MPO antibody. These results indicate that anti-MPO B cells are regulated to prevent anti-MPO antibody production and maintain tolerance in this mouse model. Much work has demonstrated that tolerance to self-antigens may be achieved by anergy, clonal deletion, or receptor editing of autoreactive B cells.14–22

An important question is whether anti-MPO B cells are functional. Generation of anti-MPO hybridomas from LC Tg mice confirmed the presence of anti-MPO B cells and demonstrated that the Vκ1C-Jκ5 Tg can confer anti-MPO specificity when combined with a variety of rearranged heavy chains. Although several of the heavy chains from Vκ1C-Jκ5 Tg hybridomas expressed the J558 variable region gene, the number of hybridomas examined was too small to ascertain whether there is a restriction in heavy-chain variable region gene use by anti-MPO B cells. Of note, one of the non-Tg light chains, Vκ12-41, expressed by hybridomas from our Vκ1C-Jκ5 Tg mice, is also expressed by another anti-MPO antibody produced by NZB × NZW mice,23 consistent with light-chain restriction. In addition, stimulation of splenocytes and purified B cells from LC Tg mice with LPS resulted in proliferation of anti-MPO B cells and production of anti-MPO–specific antibodies. These results indicate that anti-MPO B cells in LC Tg mice are not anergic; however, anti-MPO B cells in HC mice seem nonfunctional.

We examined the B cell repertoire to elucidate further the mechanisms of maintaining tolerance to MPO in this nonautoimmune mouse model. We observed >85% fewer B cells in the bone marrow of Tg mice, in part because of reduced clonal expansion at the pre-B cell stage as a result of expression of the light-chain transgene. Our data also support the deletion of anti-MPO B cells in the bone marrow. These results are similar to those found with anti-red blood cell (RBC)24 and anti-DNA Tg mice.18 Moreover, we observed a large population of apoptotic MPO-binding B cells in the spleens of Tg mice, suggesting that deletion of anti-MPO B cells continues in the periphery, most likely via the extrinsic pathway of apoptosis because caspase 8 is activated.25 Peripheral deletion of self-reactive B cells by apoptosis has been demonstrated in other Tg mouse models, including MT-κb Tg × 3-83 μδ Tg mice26 and anti-RBC Tg mice.27

In Tg mice, we observed almost complete elimination of mature recirculating B cells in the bone marrow and follicular cells in the spleen. This decreased progression of B cells to the follicular stage was accompanied by diversion of B cells to either a marginal zone or B-1 phenotype. These changes affect MPO-binding cells as well as cells that seem to be non–MPO-binding cells. A likely explanation is that there are more MPO-binding B cells present than we detect by FLOW cytometry using biotinylated MPO. B cells classified as “non–MPO-binding B cells” may actually include MPO binders with an affinity or avidity for MPO that is too low to sustain strong binding of the biotinylated MPO molecule. LC mice are characterized by a four-fold increase in the number of marginal zone B cells. This finding is consistent with considerable evidence that autoreactive B cells are selected into the marginal zone of the spleen.28–30 Marginal zone B cells may arise from autoreactive cells through the process of receptor editing, which can result in the expression of two receptors and effectively dilute the autoreactive B cell receptor signal strength.28 Such receptor editing may occur in LC Tg mice as evidenced by the fact that two anti-MPO–binding hybridomas also expressed a different light chain in addition to the Tg Vk1C-Jk5. We hypothesize that receptor editing, with a resultant lack of allelic exclusion and production of marginal zone B cells, may be one of the mechanisms used by LC Tg mice to negatively regulate autoreactive cells.

In contrast to LC mice, HC mice did not exhibit an increase in marginal zone cells but rather a marked increase in B-1 cells in the spleen. This diversion of autoreactive B cells into the B-1 compartment has been observed in other Tg mouse models.31,32 B-1 cells express high levels of CD5, a molecule known to regulate negatively B cell receptor signaling and, therefore, reduce antibody production.33 B cell antigen receptor specificity and surface density have been shown to drive B-1 versus follicular cell development.34,35 Although we detected an increase in splenic B-1 cells, not peritoneal B-1 cells, our results are comparable to those of the tandem anti-RBC heavy- and light-chain Tg mouse,35 in which homozygosity of the transgene resulted in deletion of follicular cells from both bone marrow and spleen and an increase in peritoneal B-1 cells. Our results parallel this Tg model whereby the relative copy number drove the B cell phenotype. We see an increase in marginal zone cells in our Vκ1C-Jκ5 Tg mice that have fewer copies of the transgene and a diversion of B cells to the B-1 subtype in mice with the larger relative transgene copy number. Gene copy number correlates with expression levels of the corresponding protein,30,35–39 and B cell receptor density is known to affect B cell receptor signal strength.28,34 Our results are consistent with the B cell receptor signal strength model, which proposes that B cell receptor signaling determines peripheral B cell lineage commitment.40,41 Specifically, a weak B cell receptor signal drives production of marginal zone B cells, and a strong B cell receptor signal triggers B-1 B cell production.

In conclusion, our results are consistent with a model of autoreactive B cell regulation whereby anti-MPO B cells are deleted via apoptosis in the bone marrow and in the spleen before maturation to follicular B cells. Anti-MPO B cells that survive this negative selection are diverted to a B-1 phenotype or to a marginal zone phenotype depending on B cell receptor strength, apparently determined by the relative transgene copy number. Moreover, remaining anti-MPO B cells in HC Tg mice seem to be nonfunctional.

CONCISE METHODS

Generation of Vκ1C- Jκ5 Light-Chain Tg Mice

A rearranged Vκ1c-Jκ5 light chain from an anti-MPO–specific hybridoma derived from SCG/Kj mice12 was used to produce Tg mice. Genomic DNA from the 5F2 hybridoma was used to amplify the light chain by PCR using 5′ TATAGAATTCCAGGTTCCACAGGTGATGTTTTGATGACCCAAACTC and 3′ CAGTGAATTCTCTAGAAGACCACGCTACCTG primers. The 642-bp PCR product was subcloned into a Cκ/Neo expression vector containing the endogenous Vκ21C promoter and leader sequences and Cκ secretory exons42 as similarly described for the Vκ31/Jκ4 light chain.43 Vector DNA was linearized with SalI, injected into single-cell embryos, and transferred to pseudopregnant females (CB6 or CD1). Offspring carrying the 5F2 Vκ1C-Jκ5 transgene were identified by PCR analysis using the Vκ1C forward (5′-GTTCCACAGGTGATGTTTTGAT-3′) and Vκ4long reverse (5′-AGGAGCTGAACTTGACTTCAGC-3′) primers.

Six 5F2 transgene-positive founder mice were mated to B6C3F1 mice and backcrossed to C57BL/6 (Jackson Laboratory, Bar Harbor, ME). Mice from five of six founder lines were examined and had similar phenotypes; therefore, we focused our analysis on one of the lines. HC Tg mice resulted from interbreeding of LC Tg mice from this one founder line. Mice were maintained in a pathogen-free colony at the University of North Carolina Animal Facility. All animal protocols were approved by the Institutional Animal Care and Use Committee.

Taqman Quantitative PCR

Relative copy number of genomic Vκ1C-Jκ5 Tg mice was determined using real-time quantitative PCR quantification (Taqman) on ABI Prism 7900 HT sequence detector (Applied Biosystems [ABI], Foster City, CA). Quantitative PCR primers for Vκ1C-Jκ5 (accession no. AF113232) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; accession no. BC014085) were designed using Primer Express (V1.5; ABI). Forward and reverse primer pairs were GGCAGTGGATCAGGGACAGAT (bp 216 to 237) and ACCGAACGTGAACGGAACA (bp 305 to 324) for Vκ1C-Jκ5 and GACCCCTTCATTGACCTCAACTAC and GCTCCTGGAAGATGGTGATGG for GAPDH. PCR reactions were performed using Taqman Universal PCR Master Mix (ABI) with SYBR Green (Molecular Probes, Eugene, OR) for fluorescence detection of amplified product. Primer linearity and proportionality were tested by PCR amplification of increasing dilutions of mouse genomic DNA. Relative quantification was performed by the ΔΔCt method whereby the difference or fold change (FC) between samples was determined using the following equation: FC = 2(−ΔΔCt). Relative transgene copy number was measured as a ratio to input genomic DNA as measured by GAPDH.

ELISA

Anti-MPO antibodies were detected in ELISA using native human MPO (Calbiochem, San Diego, CA), recombinant human MPO, or recombinant mouse MPO as described previously.44,45 Mouse and human recombinant MPO were expressed in HEK293 cells.45 Calf thymus DNA (Sigma, St. Louis, MO) and native human PR3 (Elastin Products Company, Owensville, MO) served as control antigens. IgM production was measured by ELISA using goat anti-mouse Ig (SouthernBiotech, Birmingham, AL) as the capture antibody as described previously.46 Plates were incubated with 100 μl of hybridoma supernatant, splenocyte or B cell culture supernatants, or mouse sera diluted 1:10 to 1:250. Mouse IgM (SouthernBiotech), anti-mouse MPO mAb 8F4 (Hycult Biotechnology, Uden, Netherlands), and anti-human MPO mAb 2C7 (Abcam, Cambridge, MA) were used as positive controls as appropriate. Alkaline phosphatase–conjugated goat anti-mouse IgG and IgM (Pierce, Rockford, IL) or goat anti-mouse IgM (SouthernBiotech) were used as secondary antibodies. Reactivity was detected with an alkaline phosphatase substrate kit (Bio-Rad Laboratories, Hercules, CA). Samples giving an OD405 value at least twice that of the negative control were considered positive.

Generation of B Cell Hybridomas

B cell hybridomas were generated from Tg mice as described previously.12 Splenocytes from Tg mice were fused with P3X-Ag8.653 or NSObcl-2 myeloma cells. After fusion, tissue culture supernatants were screened for MPO binding by ELISA. Hybridomas expressing anti-MPO antibodies were rendered monoclonal by limiting dilution. Antibody isotype analysis was performed using a mouse mAb isotyping kit (Amersham Biosciences, Little Chalfont Buckinghamshire, England).

Analysis of Hybridoma Light- and Heavy-Chain V Region Genes

Total RNA was isolated from hybridomas producing anti-MPO antibodies using RNA STAT-60 (Tel-Test, Friendswood, TX); mRNA was isolated using the Poly(A)Tract Isolation System (Promega, Madison, WI). For confirmation that the transgene was transcribed, cDNA was generated with random hexamers and Superscript RT (Life Technologies, Gaithersburg, MD) after DNase (Life Technologies BRL) treatment of the poly (A) tail RNA template. Transgene-specific primers described previously were used to amplify the transgene. The diversity in light-chain and heavy-chain variable region gene usage was determined using the 5′ Rapid Amplification of cDNA Ends system (5′RACE; Life Technologies) as described previously.12 The GSP1 primers and nested GSP2 primers used for the kappa light chain and the Mu heavy chain were as follows: κGSP1 5′-TAACTGCTCACTGGATGGTGGGAAG-3′, μGSP1 5′-CAGATTCTTATCAGACAG-3′, κGSP2 5′-ATGGATACAGTTGGTGCAGCATCAG-3′, and μGSP2 5′-GCTCTCGCAGGAGACGAG-3′.

PCR products were sequenced on an automated dye-chain termination DNA sequencer with nested constant region primers (GSP2) from the second round of PCR. Sequences were analyzed with Chromas (Technelysium, Helensvale, Australia) and Sci Ed Central (Scientific and Educational Software, Durham, NC). The Basic Local Alignment Search Tool (BLAST) was used to search the GenBank database for homology with murine V regions. IgBLAST was used to compare the sequences with the germline Ig database.

Flow Cytometry

Cells were isolated from the spleen, bone marrow, and peritoneum into HBSS containing 2% FBS as described previously.46 Cells were stained with antibodies specific for IgM, CD21, CD23, CD43, CD5, B220, CD9, and CD11c that were conjugated to FITC, phycoerythrin, or allophycocyanin (BD Biosciences Pharmingen, San Diego, CA). B cells were gated on IgM and/or B220. Biotinylated MPO followed by streptavidin-peridinin chlorophyll protein (BD Biosciences Pharmingen) was used to identify MPO-binding cells. Biotinylated PR3 served as an antigen control. MPO and PR3 (Calbiochem, San Diego, CA, or Elastin Products Company, Owensville, MO) were biotinylated using EZ-Link NHS-Biotin (Pierce). CaspACE FITC-VAD-FMK (Promega) and a CaspaTag Caspase-8 in situ assay kit using FAM-LETD-FMK (Chemicon International, Temecula, CA) were used to detect apoptotic cells. Four-color analysis of cells was performed on a FACSCalibur (Becton Dickinson, Mountain View, CA). Data were analyzed with Summit software (DakoCytomation, Fort Collins, CO).

In Vitro Stimulation

Splenocytes were harvested as described previously for flow cytometry. Enriched populations of B cells were isolated by negative selection using a B cell enrichment kit (StemCell Technologies, Vancuouver, BC, Canada) and were >90% pure. Total splenocytes or B cells were cultured in duplicate for 3 to 5 d in DMEM-H, 10% FBS without stimulation or stimulated with native human MPO (10 to 20 μg/ml; Calbiochem), LPS (10 μg/ml; Invivogen), or anti-IgM F(ab′)2 (10 μg/ml; JacksonImmunoResearch Laboratories, West Grove, PA). Supernatants were analyzed by ELISA. Proliferation of cells was measured using a CellTrace carboxyfluorescein diacetate, succinimidyl ester cell proliferation kit (Molecular Probes). Intracellular IgM was measured by blocking surface IgM with unlabeled goat anti-mouse IgM (SouthernBiotech) before permeabilization with Perm/Wash buffer (BD Biosciences Pharmingen) and subsequent staining with allophycocyanin-labeled antibody to IgM as described previously.47

Statistical Analysis

Baseline characteristics were summarized with means and SD. ANOVA tests were performed to evaluate differences in B cell variables among the three groups of mice (control, LC, and HC). Using a Duncan multiple range test to control for multiple comparisons, both the LC and HC were evaluated for statistical differences from the control group. To reduce the probability of finding differences between groups across different components of the same experiment because of multiple comparisons, a Bonferroni correction was used for adjusting the α level to maintain an overall α level of 0.05. Because 17 different components of the experiments were examined, an adjusted α level (0.05/17 = 0.003) was used. Because of small sample sizes and skewed distribution, ranked variables were used in the analysis. All statistical programming and analyses were conducted using SAS 8.2 (SAS Institute, Cary, NC).

DISCLOSURES

None.

Acknowledgments

This study was supported by National Institutes of Health, National Institute of Diabetes and Digestive and Kidney Diseases grants P01 DK58335, AI 29576, and AI 43587

We thank David Painter, Shelia Taylor, Damien Barnette, Renée Smith, Malia Yang, Caleb Stewart, Joey Cao, Joe Piscitello, Dave Bautz, and Jessica Hill for technical assistance. We thank Nirmal Khandoobhai and Jean Brown for assistance with manuscript preparation. We are grateful to Gloria Preston, Suzanne McCray, Donna Culton, Ramiro Diz, and other members of the Clarke laboratory for advice and helpful discussions.

Footnotes

  • Published online ahead of print. Publication date available at www.jasn.org.

    Supplemental information for this article is available online at http://www.jasn.org/.

REFERENCES

  1. ↵
    Jennette JC, Falk RJ: Small-vessel vasculitis. N Engl J Med 337 : 1512 –1523, 1997
    OpenUrlCrossRefPubMed
  2. ↵
    Yang JJ, Tuttle RH, Hogan SL, Taylor JG, Phillips BD, Falk RJ, Jennette JC: Target antigens for anti-neutrophil cytoplasmic autoantibodies (ANCA) are on the surface of primed and apoptotic but not unstimulated neutrophils. Clin Exp Immunol 121 : 165 –172, 2000
    OpenUrlCrossRefPubMed
  3. ↵
    Kettritz R, Choi M, Butt W, Rane M, Rolle S, Luft FC, Klein JB: Phosphatidylinositol 3-kinase controls antineutrophil cytoplasmic antibodies-induced respiratory burst in human neutrophils. J Am Soc Nephrol 13 : 1740 –1749, 2002
    OpenUrlAbstract/FREE Full Text
  4. ↵
    Xiao H, Heeringa P, Hu P, Liu Z, Zhao M, Aratani Y, Maeda N, Falk RJ, Jennette JC: Antineutrophil cytoplasmic autoantibodies specific for myeloperoxidase cause glomerulonephritis and vasculitis in mice. J Clin Invest 110 : 955 –963, 2002
    OpenUrlCrossRefPubMed
  5. Kobayashi K, Shibata T, Sugisaki T: Aggravation of rat nephrotoxic serum nephritis by anti-myeloperoxidase antibodies. Kidney Int 47 : 454 –463, 1995
    OpenUrlCrossRefPubMed
  6. Heeringa P, Brouwer E, Klok PA, Huitema MG, van den BJ, Weening JJ, Kallenberg CG: Autoantibodies to myeloperoxidase aggravate mild anti-glomerular-basement-membrane-mediated glomerular injury in the rat. Am J Pathol 149 : 1695 –1706, 1996
    OpenUrlPubMed
  7. Xiao H, Heeringa P, Liu Z, Huugen D, Hu P, Maeda N, Falk RJ, Jennette JC: The role of neutrophils in the induction of glomerulonephritis by anti-myeloperoxidase antibodies. Am J Pathol 167 : 39 –45, 2005
    OpenUrlCrossRefPubMed
  8. ↵
    Schreiber A, Xiao H, Falk RJ, Jennette JC: Bone marrow-derived cells are sufficient and necessary targets to mediate glomerulonephritis and vasculitis induced by anti-myeloperoxidase antibodies. J Am Soc Nephrol 17 : 3355 –3364, 2006
    OpenUrlAbstract/FREE Full Text
  9. ↵
    Nachman PH, Reisner HM, Yang JJ, Jennette JC, Falk RJ: Shared idiotypy among patients with myeloperoxidase-anti-neutrophil cytoplasmic autoantibody associated glomerulonephritis and vasculitis. Lab Invest 74 : 519 –527, 1996
    OpenUrlPubMed
  10. ↵
    Kinjoh K, Good RA, Nenmoto K, Ralk RJ, Jennette JC: SCG/Kj mice develop crescentic glomerulonephritis (CGN), vasculitis and MPO-specific P-ANCA. Clin Exp Immunol 101 : 53 , 1995
    OpenUrl
  11. ↵
    Neumann I, Birck R, Newman M, Schnulle P, Kriz W, Nemoto K, Yard B, Waldherr R, Van Der Woude FJ: SCG/Kinjoh mice: A model of ANCA-associated crescentic glomerulonephritis with immune deposits. Kidney Int 64 : 140 –148, 2003
    OpenUrlCrossRefPubMed
  12. ↵
    Jethwa HS, Clarke SH, Itoh-Lindstrom Y, Falk RJ, Jennette JC, Nachman PH: Restriction in V kappa gene use and antigen selection in anti-myeloperoxidase response in mice. J Immunol 165 : 3890 –3897, 2000
    OpenUrlAbstract/FREE Full Text
  13. ↵
    Loder F, Mutschler B, Ray RJ, Paige CJ, Sideras P, Torres R, Lamers MC, Carsetti R: B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J Exp Med 190 : 75 –89, 1999
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Nemazee DA, Burki K: Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes. Nature 337 : 562 –566, 1989
    OpenUrlCrossRefPubMed
  15. Goodnow CC, Crosbie J, Adelstein S, Lavoie TB, Smith-Gill SJ, Brink RA, Pritchard-Briscoe H, Wotherspoon JS, Loblay RH, Raphael K: Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334 : 676 –682, 1988
    OpenUrlCrossRefPubMed
  16. Tiegs SL, Russell DM, Nemazee D: Receptor editing in self-reactive bone marrow B cells. J Exp Med 177 : 1009 –1020, 1993
    OpenUrlAbstract/FREE Full Text
  17. Radic MZ, Erikson J, Litwin S, Weigert M: B lymphocytes may escape tolerance by revising their antigen receptors. J Exp Med 177 : 1165 –1173, 1993
    OpenUrlAbstract/FREE Full Text
  18. ↵
    Chen C, Nagy Z, Radic MZ, Hardy RR, Huszar D, Camper SA, Weigert M: The site and stage of anti-DNA B-cell deletion. Nature 373 : 252 –255, 1995
    OpenUrlCrossRefPubMed
  19. Halverson R, Torres RM, Pelanda R: Receptor editing is the main mechanism of B cell tolerance toward membrane antigens. Nat Immunol 5 : 645 –650, 2004
    OpenUrlCrossRefPubMed
  20. Hippen KL, Schram BR, Tze LE, Pape KA, Jenkins MK, Behrens TW: In vivo assessment of the relative contributions of deletion, anergy, and editing to B cell self-tolerance. J Immunol 175 : 909 –916, 2005
    OpenUrlAbstract/FREE Full Text
  21. Gauld SB, Merrell KT, Cambier JC: Silencing of autoreactive B cells by anergy: A fresh perspective. Curr Opin Immunol 18 : 292 –297, 2006
    OpenUrlCrossRefPubMed
  22. ↵
    Cambier JC, Gauld SB, Merrell KT, Vilen BJ: B-cell anergy: From transgenic models to naturally occurring anergic B cells? Nat Rev Immunol 7 : 633 –643, 2007
    OpenUrlCrossRefPubMed
  23. ↵
    Vittecoq O, Brard F, Jovelin F, Le Loet X, Tron F, Gilbert D: IgM anti-myeloperoxidase antibody-secreting lymphocytes are present in the peripheral repertoire of lupus mice but rarely differentiate into IgG-producing cells. Clin Exp Immunol 118 : 122 –130, 1999
    OpenUrlCrossRefPubMed
  24. ↵
    Okamoto M, Murakami M, Shimizu A, Ozaki S, Tsubata T, Kumagai S, Honjo T: A transgenic model of autoimmune hemolytic anemia. J Exp Med 175 : 71 –79, 1992
    OpenUrlAbstract/FREE Full Text
  25. ↵
    Chipuk JE, Green DR: Do inducers of apoptosis trigger caspase-independent cell death? Nat Rev Mol Cell Biol 6 : 268 –275, 2005
    OpenUrlCrossRefPubMed
  26. ↵
    Russell DM, Dembic Z, Morahan G, Miller JF, Burki K, Nemazee D: Peripheral deletion of self-reactive B cells. Nature 354 : 308 –311, 1991
    OpenUrlCrossRefPubMed
  27. ↵
    Murakami M, Tsubata T, Okamoto M, Shimizu A, Kumagai S, Imura H, Honjo T: Antigen-induced apoptotic death of Ly-1 B cells responsible for autoimmune disease in transgenic mice. Nature 357 : 77 –80, 1992
    OpenUrlCrossRefPubMed
  28. ↵
    Li Y, Li H, Weigert M: Autoreactive B cells in the marginal zone that express dual receptors. J Exp Med 195 : 181 –188, 2002
    OpenUrlAbstract/FREE Full Text
  29. Chen X, Martin F, Forbush KA, Perlmutter RM, Kearney JF: Evidence for selection of a population of multi-reactive B cells into the splenic marginal zone. Int Immunol 9 : 27 –41, 1997
    OpenUrlCrossRefPubMed
  30. ↵
    Casola S, Otipoby KL, Alimzhanov M, Humme S, Uyttersprot N, Kutok JL, Carroll MC, Rajewsky K: B cell receptor signal strength determines B cell fate. Nat Immunol 5 : 317 –327, 2004
    OpenUrlCrossRefPubMed
  31. ↵
    Murakami M, Honjo T: Anti-red blood cell autoantibody transgenic mice: Murine model of autoimmune hemolytic anemia. Semin Immunol 8 : 3 –9, 1996
    OpenUrlCrossRefPubMed
  32. ↵
    Wang H, Clarke SH: Positive selection focuses the VH12 B-cell repertoire towards a single B1 specificity with survival function. Immunol Rev 197 : 51 –59, 2004
    OpenUrlCrossRefPubMed
  33. ↵
    Berland R, Wortis HH: Origins and functions of B-1 cells with notes on the role of CD5. Annu Rev Immunol 20 : 253 –300, 2002
    OpenUrlCrossRefPubMed
  34. ↵
    Lam KP, Rajewsky K: B cell antigen receptor specificity and surface density together determine B-1 versus B-2 cell development. J Exp Med 190 : 471 –477, 1999
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Watanabe N, Nisitani S, Ikuta K, Suzuki M, Chiba T, Honjo T: Expression levels of B cell surface immunoglobulin regulate efficiency of allelic exclusion and size of autoreactive B-1 cell compartment. J Exp Med 190 : 461 –469, 1999
    OpenUrlAbstract/FREE Full Text
  36. Pogue SL, Goodnow CC: Gene dose-dependent maturation and receptor editing of B cells expressing immunoglobulin (Ig)G1 or IgM/IgG1 tail antigen receptors. J Exp Med 191 : 1031 –1044, 2000
    OpenUrlAbstract/FREE Full Text
  37. Feuk L, Carson AR, Scherer SW: Structural variation in the human genome. Nat Rev Genet 7 : 85 –97, 2006
    OpenUrlCrossRefPubMed
  38. Nadeau JH, Lee C: Genetics: Copies count. Nature 439 : 798 –799, 2006
    OpenUrlCrossRefPubMed
  39. ↵
    Aitman TJ, Dong R, Vyse TJ, Norsworthy PJ, Johnson MD, Smith J, Mangion J, Roberton-Lowe C, Marshall AJ, Petretto E, Hodges MD, Bhangal G, Patel SG, Sheehan-Rooney K, Duda M, Cook PR, Evans DJ, Domin J, Flint J, Boyle JJ, Pusey CD, Cook HT: Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature 439 : 851 –855, 2006
    OpenUrlCrossRefPubMed
  40. ↵
    Pillai S, Cariappa A, Moran ST: Marginal zone B cells. Annu Rev Immunol 23 : 161 –196, 2005
    OpenUrlCrossRefPubMed
  41. ↵
    Hardy RR: B-1 B cells: development, selection, natural autoantibody and leukemia. Curr Opin Immunol 18 : 547 –555, 2006
    OpenUrlCrossRefPubMed
  42. ↵
    Wloch MK: The Role of Somatic Mutation in the Immune Response to the Sb Site of Influenza Hemagglutinin [Doctoral thesis], Chapel Hill, University of North Carolina at Chapel Hill, 1993 , pp 58 –86
  43. ↵
    Retter MW, Cohen PL, Eisenberg RA, Clarke SH: Both Sm and DNA are selecting antigens in the anti-Sm B cell response in autoimmune MRL/lpr mice. J Immunol 156 : 1296 –1306, 1996
    OpenUrlAbstract
  44. ↵
    Jethwa HS, Nachman PH, Falk RJ, Jennette JC: False-positive myeloperoxidase binding activity due to DNA/anti-DNA antibody complexes: A source for analytical error in serologic evaluation of anti-neutrophil cytoplasmic autoantibodies. Clin Exp Immunol 121 : 544 –550, 2000
    OpenUrlCrossRefPubMed
  45. ↵
    Erdbrugger U, Hellmark T, Bunch DO, Alcorta DA, Jennette JC, Falk RJ, Nachman PH: Mapping of myeloperoxidase epitopes recognized by MPO-ANCA using human-mouse MPO chimers. Kidney Int 69 : 1799 –1805, 2006
    OpenUrlCrossRefPubMed
  46. ↵
    Santulli-Marotto S, Retter MW, Gee R, Mamula MJ, Clarke SH: Autoreactive B cell regulation: Peripheral induction of developmental arrest by lupus-associated autoantigens. Immunity 8 : 209 –219, 1998
    OpenUrlCrossRefPubMed
  47. ↵
    Kilmon MA, Wagner NJ, Garland AL, Lin L, Aviszus K, Wysocki LJ, Vilen BJ: Macrophages prevent the differentiation of autoreactive B cells by secreting CD40 ligand and interleukin-6. Blood 110 : 1595 –1602, 2007
    OpenUrlAbstract/FREE Full Text
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Email Article
Citation Tools
Request Permissions
Maintenance of Tolerance by Regulation of Anti-myeloperoxidase B Cells
Donna O. Bunch, Jonathan S. Silver, Melanie C. Majure, Pamela Sullivan, David A. Alcorta, Hyunsook Chin, Susan L. Hogan, Yoshi I. Lindstrom, Stephen H. Clarke, Ronald J. Falk, Patrick H. Nachman
JASN Sep 2008, 19 (9) 1763-1773; DOI: 10.1681/ASN.2007030382
del.icio.us logo Digg logo Reddit logo Twitter logo Facebook logo Google logo Mendeley logo

Jump to section