Basic Research

Shiga Toxin Promotes Podocyte Injury in Experimental Hemolytic Uremic Syndrome via Activation of the Alternative Pathway of Complement

Monica Locatelli, Simona Buelli, Anna Pezzotta, Daniela Corna, Luca Perico, Susanna Tomasoni, Daniela Rottoli, Paola Rizzo, Debora Conti, Joshua M. Thurman, Giuseppe Remuzzi, Carlamaria Zoja and Marina Morigi
JASN August 2014, 25 (8) 1786-1798; DOI: https://doi.org/10.1681/ASN.2013050450

Abstract

Shiga toxin (Stx)–producing Escherichia coli is the offending agent of postdiarrhea-associated hemolytic uremic syndrome (HUS), a disorder of glomerular ischemic damage and widespread microvascular thrombosis. We previously documented that Stx induces glomerular complement activation, generating C3a responsible for microvascular thrombosis in experimental HUS. Here, we show that the presence of C3 deposits on podocytes is associated with podocyte damage and loss in HUS mice generated by the coinjection of Stx2 and LPS. Because podocyte adhesion to the glomerular basement membrane is mediated by integrins, the relevance of integrin-linked kinase (ILK) signals in podocyte dysfunction was evaluated. Podocyte expression of ILK increased after the injection of Stx2/LPS and preceded the upregulation of Snail and downregulation of nephrin and α-actinin-4. Factor B deficiency or pretreatment with an inhibitory antibody to factor B protected mice against Stx2/LPS-induced podocyte dysregulation. Similarly, pretreatment with a C3a receptor antagonist limited podocyte loss and changes in ILK, Snail, and α-actinin-4 expression. In cultured podocytes, treatment with C3a reduced α-actinin-4 expression and promoted ILK-dependent nuclear expression of Snail and cell motility. These results suggest that Stx-induced activation of the alternative pathway of complement and generation of C3a promotes ILK signaling, leading to podocyte dysfunction and loss in Stx-HUS.

Shiga toxin (Stx)–producing Escherichia coli (STEC) is a causative agent of worldwide spread of diarrhea-associated hemolytic uremic syndrome (D+HUS), a disorder of thrombocytopenia, microangiopathic hemolytic anemia, and acute renal failure that develops principally in infants and young children.1,2 Death or permanent ESRD occurs in about 12% of patients 4 years after D+HUS, and 20%–40% of survivors demonstrate long-term renal sequelae.3

After ingestion of contaminated food or water by STEC, Stx1 and Stx2 are transported into the circulation, where they bind to the globotriaosyl ceramide receptor expressed on the surface of target cells, including the glomerular endothelium, thereby activating a cascade of signals contributing to microvascular dysfunction, leukocyte adhesion, and thrombosis.4 We documented that Stx upregulated glomerular endothelial P-selectin expression and activated complement via the alternative pathway (AP), generating exuberant glomerular C3b deposits and C3a, which was instrumental to microvascular thrombus formation.5 A role for complement activation in D+HUS was first suggested by anecdotal studies showing reduced C3 and augmented C3b, C3c, and C3d serum levels in patients with active disease.6–8 More recently, high plasma levels of Bb and C5b-9 were measured in children with D+HUS, indicating complement AP activation during the onset of the disease.9 C3 deposition was detected on platelet–leukocyte complexes from patients with the acute phase of Stx-associated HUS.10

Reports, albeit controversial, of response to eculizumab in children with Stx-HUS,11 as well in the unusual outbreak in Germany,12–16 reinforce the role of complement in mediating glomerular lesions in Stx-associated HUS. In close proximity to glomerular endothelial cells, podocytes could represent a relevant target of Stx-induced complement activation. Podocytes possess an efficient contractile apparatus composed of F-actin and associated proteins interacting with the glomerular basement membrane (GBM) via integrins.17 Integrins transduce both “inside-out” and “outside-in” signals to associated intracellular molecules, including integrin-linked kinase (ILK), which regulates podocyte cell matrix interaction, proliferation, and slit diaphragm protein expression and distribution.18 Aberrant regulation of ILK signals drives toward podocyte dysregulation, which represents a crucial event in the development of proteinuria and renal function impairment in many forms of inherited or acquired glomerular diseases.19,20 In patients with D+HUS, retraction and collapse of the capillary tuft typically occurred in association with fusion of foot processes and swelling of podocytes.7,21–23 Podocyturia was documented in 15 children with D+HUS on the basis of nephrin and synaptopodin mRNA excretion, which reflected podocyte damage and detachment from the GBM.24 Moreover, in a baboon model of HUS, swelling of podocytes was found in association with glomerular endothelial lesions.25 A direct cytotoxic effect of Stx was evidenced by the release of inflammatory and vasoactive mediators by cultured podocytes.26,27

Here we sought to investigate whether glomerular activation of the AP of complement was responsible for podocyte damage in response to Stx in experimental HUS. We also wanted to evaluate the intracellular pathways involved in the regulation of slit diaphragm–associated proteins upon exuberant C3 deposition and C3a generation at the outer aspect of the GBM and mechanisms of damage.

Results

In Vivo Studies

Glomerular Complement Activation and Deposition, via the Alternative Pathway, Cause Podocyte Injury and Loss in Stx2/LPS Mice

C57BL/6 mice injected with Stx2 plus LPS developed thrombocytopenia, renal failure, and abundant C3 and fibrin(ogen) deposition, and platelet clumps in the glomerular capillary loops.5 Here, we confirmed that excessive glomerular C3 deposits, with an irregular distribution, are present at 24 and 48 hours after Stx2/LPS injection. C3 also accumulated on podocytes, as indicated by costaining with nephrin (Figure 1A, top). In the kidney of control mice, C3 staining was confined to a linear reactivity along the Bowman's capsule. In mice deficient for factor B (Bf−/−), a zymogen that carries the catalytic site of the AP C3 and C5 convertases,28 no glomerular C3 deposits were found after Stx2/LPS injection (Figure 1A, bottom).

Figure 1.
Figure 1.

Glomerular complement activation via AP causes podocyte loss/dysfunction in mice treated with Stx2/LPS. (A) Representative images of C3 deposits (green) in glomeruli of WT (top) and factor B–deficient (Bf−/−) mice (bottom) injected with saline (control) or Stx2/LPS at 24 and 48 hours. C3 deposits (green) accumulated on podocytes, as indicated by costaining with nephrin (red; yellow when merged). Original magnification, ×630. (B) Podocyte (WT1-positive cells) number per glomerulus and podocyte density and (C) nestin expression were evaluated in WT and Bf−/− mice injected with saline (control) or Stx2/LPS. Data are expressed as mean ± SEM (n=5 mice/group). *P<0.05; **P<0.01 versus WT control; #P<0.05; ##P<0.01 versus WT+Stx2/LPS at 48 hours. (D) Representative images of VEGF staining in glomeruli of WT and Bf−/− mice at 48 hours after saline (control) or Stx2/LPS injection (n=3 mice/group). Original magnification ×630.

To establish whether complement AP activation and deposition at the glomerular level could cause podocyte dysfunction and loss in experimental HUS, we evaluated podocyte number and density in renal tissue of Stx2/LPS-treated wild-type (WT) and Bf−/− mice by staining of the podocyte marker Wilms' tumor 1 (WT1). Both podocyte number per glomerulus and the density were significantly reduced in WT mice 24 hours after Stx2/LPS injection with respect to control mice; this reduction further worsened at 48 hours (Figure 1B). By contrast, podocyte loss was limited in Bf−/− mice after Stx2/LPS, so that the number and density of cells did not differ from values found in control Bf−/− mice (Figure 1B). Quantification of WT1-positive podocytes was validated by evaluating the expression of nestin, another podocyte marker.29,30 Nestin staining gradually decreased over time in WT mice injected with Stx2/LPS with respect to control mice, whereas Stx2/LPS mice deficient for factor B had preserved nestin expression (Figure 1C).

Ultrastructural analysis showed that WT mice after Stx2/LPS injection developed podocyte damage consisting of focal effacement of foot processes, as compared with podocyte morphology of control mice (Figure 2, A–C). This change was associated with endothelial cell swelling in several but not all glomerular capillary profiles. In Bf−/− mice, no ultrastructural changes were observed after Stx2/LPS (Figure 2D).

Figure 2.
Figure 2.

Glomerular complement activation via AP causes ultrastructural podocyte damage in Stx2/LPS mice. (A) Electron micrographs show intact foot processes of podocytes in control mouse kidney. (B) In glomerular capillaries of WT mice injected with Stx2/LPS focal areas of podocyte damage with effacement of foot processes are seen (arrowheads). (C) Podocyte damage (arrowheads) is also associated with endothelial cell swelling (asterisks). (D) Bf−/− mice do not show podocyte changes after Stx2/LPS.

To substantiate that glomerular complement activation in response to Stx2/LPS led to podocyte dysfunction, we evaluated in kidney sections of WT and Bf−/− mice the expression of vascular endothelial growth factor (VEGF), a podocyte-derived survival factor.31 Glomerular VEGF expression was reduced in WT mice at 48 hours after Stx2/LPS injection with respect to control mice (score, 1.57±0.15 versus 2.02±0.04; P<0.05) (Figure 1D). At variance, no changes in VEGF expression were found in Bf−/− mice injected with Stx2/LPS (score, 2.01±0.06 versus 2.0±0.07 in controls) (Figure 1D).

Glomerular Complement Activation Alters Podocyte Expression of ILK-Dependent Signals

We studied whether complement-dependent podocyte loss could be due to dysregulation of intracellular signals consequent to activation of ILK.32 In glomeruli of control mice a faint staining for ILK was observed. The expression of ILK markedly increased in glomeruli of WT mice 24 hours after Stx2/LPS injection and persisted thereafter (Figure 3A). Glomerular ILK expression was confined to podocytes, as indicated by colocalization with nephrin (Figure 3B, inset). That complement activation was instrumental to the ILK upregulation is documented by the weak staining for ILK detected at the glomerular level in Bf−/− mice injected with Stx2/LPS (Figure 3A).

Figure 3.
Figure 3.

Glomerular complement activation induces upregulation of ILK in glomeruli of HUS mice. (A) Representative images of double staining for ILK (red) and lectin (green) in WT and Bf−/− mice injected with saline (control) or Stx2/LPS at 24 and 48 hours (n=5 mice/group). (B) ILK expression (red) in podocytes stained in adjacent sections for nephrin (green). Renal sections are counterstained with lectin and DAPI (nuclei, blue). Original magnification, ×630.

Next, we investigated the expression of Snail, a transcriptional factor induced by ILK,33 known to regulate nephrin and other relevant genes involved in podocyte dysfunction.32 In WT mice with HUS, we found an intense glomerular staining for Snail at 24 hours that increased at 48 hours in podocytes, as confirmed by colocalization with nephrin (Figure 4, A and B). No staining was observed in control mice. Factor B deficiency, by limiting ILK activation, also prevented Stx2/LPS-induced increase of Snail expression (Figure 4A). In normal glomeruli, nephrin staining revealed a linear and thick pattern along the GBM (Figure 5A). Nephrin expression in response to Stx2/LPS decreased over time in WT, but not Bf−/−, mice (Figure 5, A and B).

Figure 4.
Figure 4.

Increased podocyte expression of Snail in response to Stx2/LPS is prevented in Bf−/− mice. (A) Representative images of Snail (red) in WT and Bf−/− mice injected with saline (control) or Stx2/LPS at 24 and 48 hours (n=5 mice/group). (B) Colocalization of Snail and nephrin (green) staining is shown by yellow staining. Nuclei are stained with DAPI (blue). Original magnification, ×630.

Figure 5.
Figure 5.

Nephrin expression is preserved in Bf−/−mice injected with Stx2/LPS. (A) Representative images of nephrin expression (green) in glomeruli of WT and Bf−/− mice injected with saline (control) or Stx2/LPS at 24 and 48 hours (n=5 mice/group). Renal sections were counterstained with lectin (red) and DAPI (nuclei, blue). Original magnification, ×630. (B) Quantification of nephrin expressed as percentage of positive area. Data are expressed as mean±SEM. **P<0.01 versus WT control; ##P<0.01 versus WT+Stx2/LPS at corresponding time.

α-Actinin-4 is an important F-actin–associated protein involved in the maintenance of podocyte architecture that, by interacting with integrins, stabilizes podocytes and regulates cell migration and detachment.33–35 In WT control mice, α-actinin-4 was strongly expressed by podocytes with a staining pattern similar to that of nephrin (Figure 6A), whereas it was reduced in Stx2/LPS mice at 24 hours and even more at 48 hours (Figure 6B). No difference in α-actinin-4 expression and distribution was found in Bf−/− mice treated with Stx2/LPS (Figure 6, A and B).

Figure 6.
Figure 6.

Loss of α-actinin-4 in glomeruli of Stx2/LPS mice is prevented by blockade of the alternative pathway of complement. (A) Representative images and (B) quantification of α-actinin-4 glomerular expression (red) in WT and Bf−/− injected with saline (control) or Stx2/LPS at 24 and 48 hours. Original magnification, ×630. Data are expressed as mean±SEM (n=5 mice/group). **P<0.01 versus WT control; ##P<0.01 versus WT+Stx2/LPS at 48 hours.

Effect of Treatment with Anti–Factor B Antibody in Stx2/LPS Mice

To validate the role of complement via AP on podocyte injury studied in the genetic model of Bf−/− mice, we evaluated the pharmacologic effect of the anti–factor B mAb 137936,37 on podocyte loss, ILK, and nephrin expression in Stx2/LPS mice. We found that treatment with the anti–factor B antibody protected Stx2/LPS mice from podocyte loss and restored ILK and nephrin expression (Supplemental Figure 1).

Treatment with C3a Receptor Antagonist Limits Podocyte Injury in Stx2/LPS Mice

Finding that mice with Stx-associated HUS showed abnormal glomerular complement activation could imply local generation of C3a and its contribution in triggering dysfunction and detachment of podocytes known to express C3a receptor (R).38,39 Treatment with the C3aR antagonist SB290157 reduced podocyte ultrastructural damage (Supplemental Figure 2) and limited podocyte loss in Stx2/LPS mice with respect to mice receiving vehicle, as determined by both staining with WT1 (Figure 7A) and nestin (Supplemental Figure 3A). Blocking of C3aR prevented ILK (Figure 7B, Supplemental Figure 3B) and Snail (Figure 7B) induction in podocytes of HUS mice. Moreover, SB290157 limited nephrin mRNA downregulation (Supplemental Figure 3C) and preserved α-actinin-4 expression, as indicated by immunofluorescence staining (Figure 7B, Supplemental Figure 3D, right) and Western blot analysis of renal tissue (Supplemental Figure 3D, left). Altogether, these data suggest a direct role of C3a in podocyte dysregulation in response to Stx2/LPS.

Figure 7.
Figure 7.

C3a generated by complement activation contributes to podocyte injury in HUS mice. (A) Podocyte number assessed at 24 and 48 hours in Stx2/LPS mice treated with vehicle or C3aR antagonist (SB290157). (B) Glomerular expression of ILK, Snail, and α-actinin-4 evaluated at 24 hours in Stx2/LPS mice treated with vehicle or C3aR antagonist. (C) Platelet count and serum BUN levels measured at 24 hours in Stx2/LPS mice treated with vehicle or SB290157. Mice injected with saline were used as control. Data are expressed as mean±SEM (n=5–6 mice/group at 24 hours, n=4 mice/group at 48 hours). **P<0.01 versus control; #P<0.05; ##P<0.01 versus vehicle.

Functional in vivo analyses showed that C3aR antagonist limited the decrease of platelet count in response to Stx2/LPS (Figure 7C). Renal function, which was severely impaired in Stx2/LPS mice, was partially ameliorated by SB290157 treatment, as indicated by serum BUN levels that were numerically, albeit not significantly, lower than those in mice given vehicle (Figure 7C). Urinary albumin-to-creatinine ratios increased 24 hours after Stx2/LPS injection (106.7±21.9 μg/mg for Stx2/LPS versus 54.3±3.1 μg/mg for controls; P<0.01) and were reduced by SB290157 (47.8±2.9 μg/mg; P<0.01 versus vehicle).

In Vitro Studies: C3a Induces Snail Activation via ILK Signaling Pathway

The role of C3a on podocyte dysregulation was explored in vitro by evaluating the expression of ILK and its downstream effector Snail in differentiated human cultured podocytes exposed to exogenous C3a. Podocytes constitutively exhibited a weak cytoplasmatic ILK localization at the focal adhesion sites, while in C3a-treated cells ILK protein greatly increased and was redistributed at the cell periphery at 6 and 15 hours (Figure 8A). In untreated podocytes, Snail staining mainly localized in the cell cytoplasm. Exposure to C3a induced Snail protein expression at the nuclear level (Figure 8B, top). The percentage of cells with nuclei positive for Snail significantly increased (P<0.001) upon C3a incubation at 6 and mostly at 15 hours compared with control cells (C3a was 40.0%±2.0% at 6 hours and 46.0%±2.0% at 15 hours versus 7.2%±1.0% for control cells). When podocytes were silenced for ILK expression with small interfering mRNA (siILK), as shown by real time RT-PCR analysis (Figure 8B, middle), Snail protein expression in response to C3a was markedly reduced at 15 hours (Figure 8B, middle). Score analysis of Snail nuclear staining showed that in C3a-treated podocytes transfected with control nontarget small interfering RNA (siNull), most nuclei ranged between scores of 2 and 3 (40.1%±5.6% and 38.3%±4.3% Snail-positive nuclei, respectively) compared with control cells, which showed very weak positivity (Figure 8B, bottom). In ILK-silenced cells treated with C3a, Snail expression was limited, as shown by a significantly higher percentage of Snail-positive nuclei with scores between 0 and 1 (32.2%±2.7% and 44.8%±2.8%, respectively).

Figure 8.
Figure 8.

C3a induces ILK-dependent Snail activation in human cultured podocytes. (A) Effect of C3a (1 μM) on ILK (red) expression in human differentiated podocytes at 6 and 15 hours. Nuclei are stained with DAPI (blue). Original magnification, ×400. (B) (Top) Effect of C3a on Snail (red) protein expression in podocytes at 6 and 15 hours. (Middle) ILK mRNA expression in control podocytes or cells transfected with siNull or siILK. Data are expressed as mean±SEM (n=3 experiments). *P<0.001 versus control and siNull. Representative images showing Snail (red) expression in human podocytes transfected with siNull or siILK and exposed for 15 hours to C3a. Nuclei are stained with DAPI (blue). Original magnification, ×400. (Bottom) Semiquantitative score analysis of Snail-positive nuclei in podocytes exposed to medium (control) or transfected with siNull or siILK and then treated with C3a for 15 hours. Data are expressed as mean percentage±SEM in 15 random fields per sample (n=6 experiments). *P<0.001 versus control; #P<0.01; ##P<0.001 versus C3a+siNull.

A direct role for C3a on the regulation of α-actinin-4 expression rests on Western blot analysis data showing that exogenous C3a decreased α-actinin-4 protein expression after 6 hours compared with unstimulated cells (Figure 9A). Downregulation of α-actinin-4 persisted until 15 hours (densitometric analysis: C3a was 0.79±0.2 at 15 hours versus 1 in control cells; P<0.001).

Figure 9.
Figure 9.

C3a decreases α-actinin-4 expression and promotes ILK-dependent podocyte migration. (A) Representative Western blotting of α-actinin-4 expression in extracts of podocytes exposed to medium (control) or C3a (1 μM) for 6 hours. Densitometric analysis is expressed as mean±SEM (n=6 experiments). *P<0.001 versus control. (B) Podocyte migration evaluated by wound healing assay in cells exposed to medium alone (control), C3a, or transfected with siNull or siILK before exposure to C3a for 24 hours. Data are expressed as mean ± SEM (n=6 experiments). *P<0.01 versus control; #P<0.01 versus siILK+C3a.

Finally, we assessed whether C3a was able to modulate podocyte motility by wound healing assay. As shown in Figure 9B, exposure to C3a significantly increased podocyte migration over time compared with control cells. Moreover, ILK knocking down by siILK prevented podocyte migration in response to C3a with respect to cells transfected with siNull (Figure 9B), thereby highlighting the functional link between ILK and C3a-induced podocyte motility.

Discussion

Long-term renal prognosis of D+HUS remains a controversial issue. More than 70% of patients with STEC-HUS fully recover from the acute disease, although long-term renal sequelae have been reported in up to 20%–40% of patients who experience a critical reduction in nephron number with unsustainable remnant single-nephron hyperfiltration, proteinuria, glomerular injury, and CKD.3,40 The need for identifying determinants of glomerular damage to understand and predict the reasons for long-term renal prognosis is still a critical priority for designing targeted treatments of high-risk patients. Because kidney biopsies are rarely performed in the acute phase of the disease, few data are available to show glomerular endothelial alterations, fibrinogen, and C3 deposits in association with podocyte foot process fusion in patients with D+HUS.23 Podocyte loss was documented in patients with active D+HUS by the presence of podocyturia based on urinary excretion of mRNA for nephrin and synaptopodin, which were suggested as possible biomarkers of glomerular injury and long-term renal outcome.24

Here we take advantage of a mouse model of HUS that allowed us to previously document that Stx promotes glomerular inflammation41 and complement activation, via P-selectin, as a key mechanism of C3a-dependent loss of endothelial thromboresistance and microvascular thrombosis.5 The present study demonstrates that in Stx2/LPS-treated mice, activation and deposition of the glomerular complement proteins are functionally linked to podocyte ultrastructural damage, associated with endothelial swelling in several but not all glomerular capillaries and with a remarkable reduction of podocyte number and density, which are prevented by blockade of the complement AP activation, as observed in factor B–deficient mice.

In search for mechanisms underlying complement-dependent podocyte dysfunction and detachment, we focused on ILK, an essential component of the integrin signaling pathway. ILK is activated in the damaged podocyte and is associated with alterations in cell phenotype, cell–cell and cell–matrix interaction, and motility.32,42 Ectopic expression of exogenous ILK in cultured podocytes by adenoviral vectors, harboring FLAG-tagged ILK gene, results in suppression of nephrin and ZO-1 and de novo expression of desmin and α-smooth muscle actin, indicating cytoskeletal protein alterations with consequent disruption of slit diaphragm integrity and increased cell motility.32 On the other hand, activated ILK, possibly via phosphorylation/inactivation of its downstream target glycogen synthase kinase-3β,43 leads to increased expression of Snail,32 a direct suppressor of nephrin in podocytes.44 Dysregulation of ILK activity has been implicated in the pathogenesis of several CKDs, including diabetic nephropathy, congenital nephrotic syndrome, and experimental models of glomerular nephropathy.42,45,46 Here, we provide data showing in Stx2/LPS-treated mice a marked induction of ILK and Snail protein at the podocyte level, as documented by nephrin costaining. The finding that the expression of ILK and Snail are remarkably lower in glomeruli of factor B–deficient mice with respect to WT mice with HUS indicates a functional link between glomerular C3 activation and ILK-induced Snail pathway. Next, we have examined whether complement-dependent ILK overexpression could influence podocyte architecture and consequent glomerular filtration barrier by affecting one of the most relevant slit-diaphragm proteins, nephrin, a known target of Snail. In WT mice with HUS, podocytes exhibit a significant reduction of the characteristic pattern of nephrin staining, which is instead preserved by factor B deficiency. Another striking feature in glomeruli of Stx2/LPS mice is the aberrant distribution of α-actinin-4, an actin cross-linking protein regulating focal adhesion, intracellular tension, and cell adhesion.34,47 In this respect, data show that in α-actinin-4–deficient mice the presence of WT1-positive podocytes in the urine closely correlated with a decrease in podocyte number.34 In our experimental setting, similarly to nephrin, the pattern of α-actinin-4 protein is almost normalized in factor B–deficient mice. Besides the genetic model of factor B–deficient mice, the role of complement activation via AP pathway has also been evaluated by pharmacologic inhibition of factor B with a functional blocking antibody,36,37 showing protection from podocyte loss and restoration of ILK and nephrin expression in Stx2/LPS mice.

Our data also corroborate the novel concept that intraglomerular C3a, possibly generated during complement activation and deposition in response to Stx, is a key factor of podocyte damage. Actually, treatment with a C3aR antagonist reduces podocyte ultrastructural changes and loss by limiting ILK and Snail activation and restoring α-actinin-4. Thrombocytopenia and renal function also improved. These findings would indicate C3a as a potential new target for clinical therapeutic strategies in D+HUS.

The possible intracellular pathways underlying C3a-dependent podocyte dysfunction are highlighted in Figure 10. The mechanisms identified in the in vivo model have been further validated by experiments in cultured podocytes showing a direct role for C3a as mediator of ILK-dependent Snail activation. Cells exposed to C3a exhibit a marked redistribution/increase of ILK staining, associated with enhanced nuclear Snail and reduced α-actinin-4 protein expression that are both normalized by ILK silencing. Our data are consistent with a study showing that podocyte-specific ablation of ILK caused aberrant distribution of nephrin and α-actinin-4, which indicates that ILK is essential in specifying the distribution of slit diaphragm–associated proteins and in preserving podocyte architecture.18 Of interest, podocyte lines generated from α-actinin-4–deficient mice were less adherent than WT cells to the GBM matrix components.34 We finally demonstrate that C3a added exogenously to podocytes markedly increases cell motility in a time-dependent manner. It is key mechanistically that when ILK—and consequently ILK-dependent Snail activation—is inhibited by small interfering RNA, we observe normalization of C3a-dependent podocyte motility, pointing to ILK as a relevant mediator of complement-dependent podocyte dysregulation. The enhanced cell motility induced by C3a possibly reflects, in vivo, a condition of podocyte phenotypic alteration translating into abnormal cell–cell interaction and cell–matrix adhesion to GBM that can lead to cell detachment and disruption of the glomerular filtration barrier.34

Figure 10.
Figure 10.

C3a generated by glomerular complement activation via AP in response to Stx causes podocyte dysfunction. The scheme summarizes the possible sequence of events through which C3a, by binding C3aR on podocyte surface can stimulate, via phosphatidylinositol 3-kinase (PI3K), ILK activity that, in turn, can inhibit glycogen synthase kinase (GSK)-3β. The inhibition of the GSK-3β leads to increased Snail expression and nuclear localization and the consequent downregulation of nephrin expression.

In conclusion, our study strengthens the notion that Stx-dependent glomerular complement deposition and C3a generation play a determinant role in the development of podocyte structural abnormalities and loss, intrinsically coupled to ILK-dependent signaling. Should the present finding of complement AP activation be documented in human Stx-associated HUS, drugs such as eculizumab, already used for atypical HUS with astonishing results,48,49 will represent a valuable treatment option, at least for patients who have Stx-HUS and neurologic signs or who need dialysis.

Concise Methods

Experimental Model of HUS

Male C57BL/6 mice were obtained from Charles River Laboratories Italia (Lecco, Italy). Factor B–deficient (Bf−/−) mice of C57BL/6 genetic background50 and WT mice were a kind gift of Dr. Marina Botto (Imperial College, London, UK). For the study, Bf−/− mice and control WT littermates were obtained by heterozygote×heterozygote matings at Mario Negri Institute. Genotypes were determined by PCR.50 Animal care and treatment were in accordance with institutional guidelines in compliance with national and international laws and policies.5 Animal studies were approved by the institutional animal care and use committees of Mario Negri Institute, Milan, Italy. HUS was induced in mice (26–28 g body weight) by intraperitoneal injection of Stx2 (100 ng per mouse; Toxin Technology, Sarasota, FL) plus LPS (50 μg per mouse; O111:B4; Sigma-Aldrich, St. Louis, MO). Mice injected with saline served as controls. Stx2 was chosen because it is associated with HUS clinical isolates more often than Stx151 and because of the evidence that Stx2 injected in mice is more toxic and accumulates in the kidney to a greater extent that does Stx1.52 Mice were euthanized at 24 or 48 hours after injection. Selected experiments included treatment of HUS mice with the C3aR antagonist SB290157 (Calbiochem, EMD Millipore Corp., Billerica, MA) at a dose of 15 mg/kg intraperitoneally five times a day (i.e., 1 hour before and 1, 4, 8, and 23 hours after Stx2/LPS injection) or an equal volume of vehicle. For mice followed until 48 hours, four additional injections of SB290157 were performed (i.e., 26, 30, 34, and 47 hours after Stx2/LPS). Blood platelet count, renal function measured by serum BUN (Reflotron test; Roche Diagnostics, Basel, Switzerland), urinary albumin (ELISA; Albwell M Exocell, Philadelphia, PA), and urinary creatinine (Cobas Mira autoanalyzer; Roche Diagnostics) were assessed. Additional mice were treated with anti–factor B mAb 1379, an inhibitor of the alternative pathway of complement,36,37 at a dose of 3 mg per mouse intraperitoneally, or with PBS, 2 hours before Stx2/LPS injection; the mice were euthanized at 24 hours. A second dose of mAb 1379 was administered (at 24 hours) to mice euthanized at 48 hours after Stx2/LPS.

Immunofluorescence and Immunohistochemistry Analysis in Renal Tissue

C3 deposits were evaluated by incubating 3-μm periodate lysine paraformaldehyde–fixed renal samples with FITC-conjugated goat anti-mouse C3 antibody (1:200; Cappel, Durham, NC). Stainings for ILK and nephrin were performed in optimal cutting temperature–frozen serial sections incubated with rabbit anti-ILK antibody (1:200; Abcam, Cambridge, UK) or goat anti-nephrin antibody (1:100; Santa Cruz Biotechnology, Santa Cruz, CA), followed by Cy3 or FITC-conjugated secondary antibody (1:100 or 1:400; Jackson ImmunoResearch Laboratories, West Grove, PA). Snail and α-actinin-4 were detected in periodate lysine paraformaldehyde–fixed frozen kidney samples by using rabbit anti-Snail antibody (1:400; Abcam) and rabbit anti–α-actinin-4 antibody (1:300; OriGene Technologies, Rockville, MD), followed by Cy3-conjugated secondary antibody (1:200; Jackson ImmunoResearch Laboratories). Nuclei and cell membranes were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) and rhodamine or FITC–wheat germ agglutinin–lectin, respectively. Positive stainings of nephrin and α-actinin-4 were quantified in 15–20 glomeruli randomly selected in each section, by using ImageJ software (National Institutes of Health, Bethesda, MD) expressing the positive areas as a percentage of the total area. Negative controls were obtained by omitting the primary antibody on adjacent sections. Samples were examined under confocal inverted laser microscopy (LSM 510 Meta; Zeiss, Jena, Germany). An immunoperoxidase method53 was used for detection of VEGF using goat anti-VEGF antibody (1:10; R&D Systems, Minneapolis, MN). Intensity of glomerular VEGF signal was graded on a scale of 0–3 (0, no staining; 1, weak staining; 2, staining of moderate intensity; 3, strong staining). Negative controls were obtained by omitting the primary antibody on adjacent sections (data not shown).

Glomerular Podocyte Quantification

Podocytes were identified as cells positive for WT1. Optical cutting temperature–frozen kidney sections were incubated with rabbit anti-WT1 antibody (1:400; Santa Cruz Biotechnology), followed by Cy3-conjugated goat anti-rabbit IgG (1:100; Jackson ImmunoResearch Laboratories). Nuclei and cell membranes were counterstained with DAPI and FITC–wheat germ agglutinin–lectin. At least 30 glomeruli per section for each animal were randomly acquired by confocal laser scanning microscope. The estimation of the average number of podocytes per glomerulus and the glomerular volume were determined by morphometric analysis proposed by Weibel.54 The number of podocytes per glomerular volume was calculated using a computer-based image-analysis system (Mac OS 09; Apple Computer, Cupertino, CA) as previously described.55 In addition, podocyte area was quantified by evaluating nestin expression with a rat anti-mouse nestin (1:300; Abcam) followed by FITC goat anti-rat antibody (1:100; Jackson ImmunoResearch Laboratories).

Renal Ultrastructural Analysis

Fragments of kidney tissue were processed as described elsewhere.41 Ultrathin sections were stained with uranyl acetate and lead citrate and examined using a transmission electron microscope (Morgagni 268D; Philips, Brno, Czech Republic).

Cell Culture and Incubation

Conditionally immortalized human podocytes (kindly provided by Dr. Saleem Children’s Renal Unit and Academic Renal Unit, University of Bristol, UK) were grown as previously described.56 Briefly, cells were cultured under growth-permissive conditions at 33°C in RPMI 1640 medium (Invitrogen, Gaithersburg, MA) supplemented with 10% FBS (Invitrogen), insulin (10 μg/ml), transferrin (5.5 μg/ml), and sodium selenite (5 ng/ml) (Invitrogen) and 100 U/ml penicillin plus 0.1 mg/ml streptomycin (GIBCO-Invitrogen). To induce differentiation, podocytes were grown on rat collagen type I (BD Bioscience, Franklin Lakes, NJ) and maintained in nonpermissive conditions at 37°C for 12 days. Fifteen hours before and during the experiments, podocytes were maintained in serum free conditions. Podocytes were incubated with exogenous C3a (1 μM; Calbiochem) or medium alone for different time periods; protein expression of ILK, Snail, α-actinin-4, and cell migration were then studied.

Immunofluorescence Analysis In Vitro

Cells fixed in 2% paraformaldehyde (Electron Microscopy Science, Hatfield, PA) and 4% sucrose (Sigma-Aldrich, Milan, Italy) were incubated with 0.3% Triton X-100 (Sigma-Aldrich) and then with blocking solution consisting of 2% FBS (Invitrogen), 2% BSA (Sigma-Aldrich), and 0.2% bovine gelatin (Sigma-Aldrich). Cells were incubated with rabbit monoclonal anti-ILK antibody (1:250; Abcam) or with rabbit polyclonal anti-Snail antibody (1:200; Abcam) and then with goat anti-rabbit Cy3-conjugated as secondary antibody (1:80; Jackson ImmunoResearch Laboratories). Cells nuclei were stained with DAPI. Samples were examined under confocal inverted laser microscopy (LSM 510 Meta). Quantification of Snail-positive nuclei per total number of DAPI-positive nuclei was assessed in 15 random fields per sample.

Silencing of ILK Gene

Human podocytes were transfected by Nucleofection (Amaxa) with ON-Target plus SMART pool (Dharmacon; L-004499–00–0005) siILK or siNull (Silencer Select Negative Control #2 siRNA; Ambion) using the Amaxa Human NHDF Nucleofector Kit (VPE-1001; LONZA). Forty-eight hours after transfection, silencing of ILK was confirmed by real time RT-PCR. Podocytes transfected or not transfected with siNull or siILK were exposed to control medium or exogenous human C3a (1 μM; Calbiochem) for 24 hours and were analyzed for wound healing assay. For quantification of Snail staining, the nuclear signal in control cells, siNULL-transfected or siILK- transfected podocytes was graded on a scale of 0 to 3 (Snail expression: score 0=no nuclear staining; score 1=1%–30% nuclear staining; score 2=31%–60% nuclear staining; and score 3=61%–100% nuclear staining) in 15 random fields per sample.

Wound Healing Assay

Migration was assessed in confluent podocytes scratched with a 200-μl pipette tip to create a cell-free denuded area. Before scratching, cells were transfected or not transfected with siNull or siILK and then incubated with exogenous human C3a (1 μM) for 24 hours. Control cells exposed to medium alone were also tested. Podocytes were monitored by phase-contrast under a 10× objective on time-lapse microscopy (Axio Imager.z2 microscopy; Zeiss). Images were taken at different time intervals (2, 6, 10, 16, 20, and 24 hours), and the number of cells migrated into the wound track was counted at each time point (n=5 fields per well).

Quantitative Real-Time PCR

Total RNA was isolated from mouse renal tissue or human podocytes by TRIzol Reagent (Invitrogen). Contaminating genomic DNA was removed by RNase-free DNase (Promega, Ingelheim, Germany) for 1 hour at 37°C. Two micrograms of purified RNA was reverse transcribed using random hexamers (50 ng) and 50 U of SuperScript II RT (Invitrogen) for 1 hour at 42°C. No enzyme was added for reverse transcription–negative controls. Amplification was performed on 7300 Real Time PCR System with SYBR Green PCR Master Mix (Applied Biosystems) according to the manufacturer’s protocol. The following primers were used: mouse nephrin (300 nM) forward 5′- TTTCTACCGCCTCAACGTGTT -3′, reverse 5′- GCACTTGCTCTCCCAGGAACT -3′; mouse GAPDH (300 nM) forward 5′- TCATCCCTGCATCCACTGGT -3′, reverse 5′- CTGGGATGACCTTGCCCA -3′; human ILK (300 nM) forward 5′- GCAGCCCGAGTCCCGAGGATA-3′, reverse 5′- GCGCCGAGTCCCCTGGATTG-3′; 18S (50 nM) forward 5′- ACGGCTACCACATCCAAGGA -3′, reverse 5′-CGGGAGTGGGGTAATTTGCG-3′. The ΔΔCt technique was used to calculate cDNA content in each sample using the cDNA expression in renal tissue from WT control mice or human control podocytes as calibrator.

Western Blot Analysis

Frozen kidney tissues were homogenized in lysis buffer (50 mM HEPES [pH 7.4], 150 mM NaCl, 10% glycerol, 1% Triton X-100, Sigma-Aldrich protease inhibitor cocktail), whereas cultured podocytes were lysed in radioimmunoprecipitation assay buffer (0.1% sodium dodecyl sulfate, 0.5% deoxycholate, 1% Triton X-100, 20 mM HEPES [pH 7.5], 150 mmol/L NaCl, 1 mM EDTA, Sigma-Aldrich protease inhibitor cocktail). Protein concentration was determined by DC assay (Bio-Rad Laboratories, Hercules, CA). Equal amounts of proteins were separated on SDS-PAGE under reducing conditions and transferred to nitrocellulose or polyvinylidene difluoride membranes (Bio-Rad Laboratories). After blocking with 5% BSA in Tris-buffered saline supplemented with 0.1% Tween-20 (Sigma-Aldrich), membranes were incubated with a rabbit monoclonal anti–α-actinin-4 antibody (1:1000; OriGene Technologies). A rabbit anti-actin antibody (1:3000; Sigma-Aldrich) was used to control for loading differences. The signal was visualized using goat anti-rabbit horseradish peroxidase–conjugated secondary antibodies and ECL Western blotting Detection Reagent (Thermo Fisher Scientific, Rockford, IL). Bands were quantified by densitometry using ImageJ software.

Statistical Analyses

Results are expressed as mean±SEM. Data were analyzed by the nonparametric Mann–Whitney or Kruskal–Wallis test or by ANOVA coupled with Bonferroni post hoc analysis, as appropriate. P values <0.05 were considered to represent statistically significant differences.

Disclosures

None.

Acknowledgments

We thank Mauro Abbate and Marina Noris for helpful suggestions and criticism and Lorena Longaretti and Cristina Zanchi for real time RT-PCR experiments. We are indebted to Giovanna Barcella, Romana Stacchetti, Cinzia Calvi, and Luciana Prometti for animal care. Manuela Passera helped in preparing the manuscript. Paola Rizzo is a recipient of a fellowship from Fondazione Aiuti per la Ricerca sulle Malattie Rare (ARMR), Bergamo, Italy.

Footnotes

References

  1. ↵
    1. Tarr PI,
    2. Gordon CA,
    3. Chandler WL
    : Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365: 1073–1086, 2005pmid:15781103
    OpenUrlCrossRefPubMed
  2. ↵
    1. Noris M,
    2. Remuzzi G
    : Hemolytic uremic syndrome. J Am Soc Nephrol 16: 1035–1050, 2005pmid:15728781
    OpenUrlFREE Full Text
  3. ↵
    1. Garg AX,
    2. Suri RS,
    3. Barrowman N,
    4. Rehman F,
    5. Matsell D,
    6. Rosas-Arellano MP,
    7. Salvadori M,
    8. Haynes RB,
    9. Clark WF
    : Long-term renal prognosis of diarrhea-associated hemolytic uremic syndrome: A systematic review, meta-analysis, and meta-regression. JAMA 290: 1360–1370, 2003pmid:12966129
    OpenUrlCrossRefPubMed
  4. ↵
    1. Zoja C,
    2. Buelli S,
    3. Morigi M
    : Shiga toxin-associated hemolytic uremic syndrome: Pathophysiology of endothelial dysfunction. Pediatr Nephrol 25: 2231–2240, 2010pmid:20424866
    OpenUrlCrossRefPubMed
  5. ↵
    1. Morigi M,
    2. Galbusera M,
    3. Gastoldi S,
    4. Locatelli M,
    5. Buelli S,
    6. Pezzotta A,
    7. Pagani C,
    8. Noris M,
    9. Gobbi M,
    10. Stravalaci M,
    11. Rottoli D,
    12. Tedesco F,
    13. Remuzzi G,
    14. Zoja C
    : Alternative pathway activation of complement by Shiga toxin promotes exuberant C3a formation that triggers microvascular thrombosis. J Immunol 187: 172–180, 2011pmid:21642543
    OpenUrlAbstract/FREE Full Text
  6. ↵
    1. Monnens L,
    2. Molenaar J,
    3. Lambert PH,
    4. Proesmans W,
    5. van Munster P
    : The complement system in hemolytic-uremic syndrome in childhood. Clin Nephrol 13: 168–171, 1980pmid:7379368
    OpenUrlPubMed
  7. ↵
    1. Koster FT,
    2. Boonpucknavig V,
    3. Sujaho S,
    4. Gilman RH,
    5. Rahaman MM
    : Renal histopathology in the hemolytic-uremic syndrome following shigellosis. Clin Nephrol 21: 126–133, 1984pmid:6373079
    OpenUrlPubMed
  8. ↵
    1. Robson WL,
    2. Leung AK,
    3. Fick GH,
    4. McKenna AI
    : Hypocomplementemia and leukocytosis in diarrhea-associated hemolytic uremic syndrome. Nephron 62: 296–299, 1992pmid:1436342
    OpenUrlCrossRefPubMed
  9. ↵
    1. Thurman JM,
    2. Marians R,
    3. Emlen W,
    4. Wood S,
    5. Smith C,
    6. Akana H,
    7. Holers VM,
    8. Lesser M,
    9. Kline M,
    10. Hoffman C,
    11. Christen E,
    12. Trachtman H
    : Alternative pathway of complement in children with diarrhea-associated hemolytic uremic syndrome. Clin J Am Soc Nephrol 4: 1920–1924, 2009pmid:19820137
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Ståhl AL,
    2. Sartz L,
    3. Karpman D
    : Complement activation on platelet-leukocyte complexes and microparticles in enterohemorrhagic Escherichia coli-induced hemolytic uremic syndrome. Blood 117: 5503–5513, 2011pmid:21447825
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Lapeyraque AL,
    2. Malina M,
    3. Fremeaux-Bacchi V,
    4. Boppel T,
    5. Kirschfink M,
    6. Oualha M,
    7. Proulx F,
    8. Clermont MJ,
    9. Le Deist F,
    10. Niaudet P,
    11. Schaefer F
    : Eculizumab in severe Shiga-toxin-associated HUS. N Engl J Med 364: 2561–2563, 2011pmid:21612462
    OpenUrlCrossRefPubMed
  12. ↵
    Stahl R: Eculizumab experience in HUS. Presented at the 2011 American Society of Nephrology Kidney Week, Philadelphia, PA, November 8–13, 2011
    1. Menne J,
    2. Nitschke M,
    3. Stingele R,
    4. Abu-Tair M,
    5. Beneke J,
    6. Bramstedt J,
    7. Bremer JP,
    8. Brunkhorst R,
    9. Busch V,
    10. Dengler R,
    11. Deuschl G,
    12. Fellermann K,
    13. Fickenscher H,
    14. Gerigk C,
    15. Goettsche A,
    16. Greeve J,
    17. Hafer C,
    18. Hagenmüller F,
    19. Haller H,
    20. Herget-Rosenthal S,
    21. Hertenstein B,
    22. Hofmann C,
    23. Lang M,
    24. Kielstein JT,
    25. Klostermeier UC,
    26. Knobloch J,
    27. Kuehbacher M,
    28. Kunzendorf U,
    29. Lehnert H,
    30. Manns MP,
    31. Menne TF,
    32. Meyer TN,
    33. Michael C,
    34. Münte T,
    35. Neumann-Grutzeck C,
    36. Nuernberger J,
    37. Pavenstaedt H,
    38. Ramazan L,
    39. Renders L,
    40. Repenthin J,
    41. Ries W,
    42. Rohr A,
    43. Rump LC,
    44. Samuelsson O,
    45. Sayk F,
    46. Schmidt BM,
    47. Schnatter S,
    48. Schöcklmann H,
    49. Schreiber S,
    50. von Seydewitz CU,
    51. Steinhoff J,
    52. Stracke S,
    53. Suerbaum S,
    54. van de Loo A,
    55. Vischedyk M,
    56. Weissenborn K,
    57. Wellhöner P,
    58. Wiesner M,
    59. Zeissig S,
    60. Büning J,
    61. Schiffer M,
    62. Kuehbacher T,
    63. EHEC-HUS consortium
    : Validation of treatment strategies for enterohaemorrhagic Escherichia coli O104:H4 induced haemolytic uraemic syndrome: case-control study. BMJ 345: e4565, 2012pmid:22815429
    OpenUrlAbstract/FREE Full Text
    1. Kielstein JT,
    2. Beutel G,
    3. Fleig S,
    4. Steinhoff J,
    5. Meyer TN,
    6. Hafer C,
    7. Kuhlmann U,
    8. Bramstedt J,
    9. Panzer U,
    10. Vischedyk M,
    11. Busch V,
    12. Ries W,
    13. Mitzner S,
    14. Mees S,
    15. Stracke S,
    16. Nürnberger J,
    17. Gerke P,
    18. Wiesner M,
    19. Sucke B,
    20. Abu-Tair M,
    21. Kribben A,
    22. Klause N,
    23. Schindler R,
    24. Merkel F,
    25. Schnatter S,
    26. Dorresteijn EM,
    27. Samuelsson O,
    28. Brunkhorst R,
    29. Collaborators of the DGfN STEC-HUS registry
    : Best supportive care and therapeutic plasma exchange with or without eculizumab in Shiga-toxin-producing E. coli O104:H4 induced haemolytic-uraemic syndrome: an analysis of the German STEC-HUS registry. Nephrol Dial Transplant 27: 3807–3815, 2012pmid:23114903
    OpenUrlAbstract/FREE Full Text
    1. Loos S,
    2. Ahlenstiel T,
    3. Kranz B,
    4. Staude H,
    5. Pape L,
    6. Härtel C,
    7. Vester U,
    8. Buchtala L,
    9. Benz K,
    10. Hoppe B,
    11. Beringer O,
    12. Krause M,
    13. Müller D,
    14. Pohl M,
    15. Lemke J,
    16. Hillebrand G,
    17. Kreuzer M,
    18. König J,
    19. Wigger M,
    20. Konrad M,
    21. Haffner D,
    22. Oh J,
    23. Kemper MJ
    : An outbreak of Shiga toxin-producing Escherichia coli O104:H4 hemolytic uremic syndrome in Germany: Presentation and short-term outcome in children. Clin Infect Dis 55: 753–759, 2012pmid:22670043
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Ruggenenti P,
    2. Remuzzi G
    : Thrombotic microangiopathy: E. coli O104:H4 German outbreak: a missed opportunity. Nat Rev Nephrol 8: 558–560, 2012pmid:22945489
    OpenUrlCrossRefPubMed
  17. ↵
    1. Welsh GI,
    2. Saleem MA
    : The podocyte cytoskeleton—key to a functioning glomerulus in health and disease. Nat Rev Nephrol 8: 14–21, 2012pmid:22025085
    OpenUrlPubMed
  18. ↵
    1. Dai C,
    2. Stolz DB,
    3. Bastacky SI,
    4. St-Arnaud R,
    5. Wu C,
    6. Dedhar S,
    7. Liu Y
    : Essential role of integrin-linked kinase in podocyte biology: Bridging the integrin and slit diaphragm signaling. J Am Soc Nephrol 17: 2164–2175, 2006pmid:16837631
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Pavenstädt H,
    2. Kriz W,
    3. Kretzler M
    : Cell biology of the glomerular podocyte. Physiol Rev 83: 253–307, 2003pmid:12506131
    OpenUrlAbstract/FREE Full Text
  20. ↵
    1. Benzing T
    : Signaling at the slit diaphragm. J Am Soc Nephrol 15: 1382–1391, 2004pmid:15153549
    OpenUrlFREE Full Text
  21. ↵
    Habib R: Pathology of the hemolytic uremic syndrome. In: Hemolytic Uremic Syndrome and Thrombotyc Thrombocytopenic Purpura, edited by Kaplan BS, Trompeter RS, Moake JL, New York, Marcel Dekker, Inc., 1992, pp 315–353
  22. Striker GE, Striker LJ, D'Agati V: Renal lesions in hypertension. In: The Renal Biopsy: Volume 8 in the Major Problems in Pathology Series, 3rd Ed., Philadelphia, W.B. Saunders, 1997, pp 258–268
  23. ↵
    1. Gonzalo A,
    2. Mampaso F,
    3. Gallego N,
    4. Bellas C,
    5. Segui J,
    6. Ortuño J
    : Hemolytic uremic syndrome with hypocomplementemia and deposits of IgM and C3 in the involved renal tissue. Clin Nephrol 16: 193–199, 1981pmid:7028337
    OpenUrlPubMed
  24. ↵
    1. De Petris L,
    2. Patrick J,
    3. Christen E,
    4. Trachtman H
    : Urinary podocyte mRNA excretion in children with D+HUS: A potential marker of long-term outcome. Ren Fail 28: 475–482, 2006pmid:16928616
    OpenUrlCrossRefPubMed
  25. ↵
    1. Taylor FB Jr,
    2. Tesh VL,
    3. DeBault L,
    4. Li A,
    5. Chang AC,
    6. Kosanke SD,
    7. Pysher TJ,
    8. Siegler RL
    : Characterization of the baboon responses to Shiga-like toxin: Descriptive study of a new primate model of toxic responses to Stx-1. Am J Pathol 154: 1285–1299, 1999pmid:10233866
    OpenUrlCrossRefPubMed
  26. ↵
    1. Morigi M,
    2. Buelli S,
    3. Zanchi C,
    4. Longaretti L,
    5. Macconi D,
    6. Benigni A,
    7. Moioli D,
    8. Remuzzi G,
    9. Zoja C
    : Shigatoxin-induced endothelin-1 expression in cultured podocytes autocrinally mediates actin remodeling. Am J Pathol 169: 1965–1975, 2006pmid:17148661
    OpenUrlCrossRefPubMed
  27. ↵
    1. Hughes AK,
    2. Stricklett PK,
    3. Schmid D,
    4. Kohan DE
    : Cytotoxic effect of Shiga toxin-1 on human glomerular epithelial cells. Kidney Int 57: 2350–2359, 2000pmid:10844605
    OpenUrlCrossRefPubMed
  28. ↵
    1. Walport MJ
    : Complement. First of two parts. N Engl J Med 344: 1058–1066, 2001pmid:11287977
    OpenUrlCrossRefPubMed
  29. ↵
    1. Perry J,
    2. Ho M,
    3. Viero S,
    4. Zheng K,
    5. Jacobs R,
    6. Thorner PS
    : The intermediate filament nestin is highly expressed in normal human podocytes and podocytes in glomerular disease. Pediatr Dev Pathol 10: 369–382, 2007pmid:17929992
    OpenUrlCrossRefPubMed
  30. ↵
    1. Zoja C,
    2. Garcia PB,
    3. Rota C,
    4. Conti S,
    5. Gagliardini E,
    6. Corna D,
    7. Zanchi C,
    8. Bigini P,
    9. Benigni A,
    10. Remuzzi G,
    11. Morigi M
    : Mesenchymal stem cell therapy promotes renal repair by limiting glomerular podocyte and progenitor cell dysfunction in adriamycin-induced nephropathy. Am J Physiol Renal Physiol 303: F1370–F1381, 2012pmid:22952284
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Guan F,
    2. Villegas G,
    3. Teichman J,
    4. Mundel P,
    5. Tufro A
    : Autocrine VEGF-A system in podocytes regulates podocin and its interaction with CD2AP. Am J Physiol Renal Physiol 291: F422–F428, 2006pmid:16597608
    OpenUrlAbstract/FREE Full Text
  32. ↵
    1. Kang YS,
    2. Li Y,
    3. Dai C,
    4. Kiss LP,
    5. Wu C,
    6. Liu Y
    : Inhibition of integrin-linked kinase blocks podocyte epithelial-mesenchymal transition and ameliorates proteinuria. Kidney Int 78: 363–373, 2010pmid:20505657
    OpenUrlCrossRefPubMed
  33. ↵
    1. Dai C,
    2. Stolz DB,
    3. Kiss LP,
    4. Monga SP,
    5. Holzman LB,
    6. Liu Y
    : Wnt/beta-catenin signaling promotes podocyte dysfunction and albuminuria. J Am Soc Nephrol 20: 1997–2008, 2009pmid:19628668
    OpenUrlAbstract/FREE Full Text
  34. ↵
    1. Dandapani SV,
    2. Sugimoto H,
    3. Matthews BD,
    4. Kolb RJ,
    5. Sinha S,
    6. Gerszten RE,
    7. Zhou J,
    8. Ingber DE,
    9. Kalluri R,
    10. Pollak MR
    : Alpha-actinin-4 is required for normal podocyte adhesion. J Biol Chem 282: 467–477, 2007pmid:17082197
    OpenUrlAbstract/FREE Full Text
  35. ↵
    1. Michaud JL,
    2. Chaisson KM,
    3. Parks RJ,
    4. Kennedy CR
    : FSGS-associated alpha-actinin-4 (K256E) impairs cytoskeletal dynamics in podocytes. Kidney Int 70: 1054–1061, 2006pmid:16837921
    OpenUrlCrossRefPubMed
  36. ↵
    1. Thurman JM,
    2. Kraus DM,
    3. Girardi G,
    4. Hourcade D,
    5. Kang HJ,
    6. Royer PA,
    7. Mitchell LM,
    8. Giclas PC,
    9. Salmon J,
    10. Gilkeson G,
    11. Holers VM
    : A novel inhibitor of the alternative complement pathway prevents antiphospholipid antibody-induced pregnancy loss in mice. Mol Immunol 42: 87–97, 2005pmid:15488947
    OpenUrlCrossRefPubMed
  37. ↵
    1. Thurman JM,
    2. Royer PA,
    3. Ljubanovic D,
    4. Dursun B,
    5. Lenderink AM,
    6. Edelstein CL,
    7. Holers VM
    : Treatment with an inhibitory monoclonal antibody to mouse factor B protects mice from induction of apoptosis and renal ischemia/reperfusion injury. J Am Soc Nephrol 17: 707–715, 2006pmid:16467447
    OpenUrlAbstract/FREE Full Text
  38. ↵
    1. Bao L,
    2. Osawe I,
    3. Haas M,
    4. Quigg RJ
    : Signaling through up-regulated C3a receptor is key to the development of experimental lupus nephritis. J Immunol 175: 1947–1955, 2005pmid:16034139
    OpenUrlAbstract/FREE Full Text
  39. ↵
    1. Braun MC,
    2. Reins RY,
    3. Li TB,
    4. Hollmann TJ,
    5. Dutta R,
    6. Rick WA,
    7. Teng BB,
    8. Ke B
    : Renal expression of the C3a receptor and functional responses of primary human proximal tubular epithelial cells. J Immunol 173: 4190–4196, 2004pmid:15356170
    OpenUrlAbstract/FREE Full Text
  40. ↵
    1. Spinale JM,
    2. Ruebner RL,
    3. Copelovitch L,
    4. Kaplan BS
    : Long-term outcomes of Shiga toxin hemolytic uremic syndrome. Pediatr Nephrol 28: 2097–2105, 2013pmid:23288350
    OpenUrlCrossRefPubMed
  41. ↵
    1. Zanchi C,
    2. Zoja C,
    3. Morigi M,
    4. Valsecchi F,
    5. Liu XY,
    6. Rottoli D,
    7. Locatelli M,
    8. Buelli S,
    9. Pezzotta A,
    10. Mapelli P,
    11. Geelen J,
    12. Remuzzi G,
    13. Hawiger J
    : Fractalkine and CX3CR1 mediate leukocyte capture by endothelium in response to Shiga toxin. J Immunol 181: 1460–1469, 2008pmid:18606701
    OpenUrlAbstract/FREE Full Text
  42. ↵
    1. Kretzler M,
    2. Teixeira VP,
    3. Unschuld PG,
    4. Cohen CD,
    5. Wanke R,
    6. Edenhofer I,
    7. Mundel P,
    8. Schlöndorff D,
    9. Holthöfer H
    : Integrin-linked kinase as a candidate downstream effector in proteinuria. FASEB J 15: 1843–1845, 2001pmid:11481249
    OpenUrlFREE Full Text
  43. ↵
    1. Delcommenne M,
    2. Tan C,
    3. Gray V,
    4. Rue L,
    5. Woodgett J,
    6. Dedhar S
    : Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc Natl Acad Sci U S A 95: 11211–11216, 1998pmid:9736715
    OpenUrlAbstract/FREE Full Text
  44. ↵
    1. Matsui I,
    2. Ito T,
    3. Kurihara H,
    4. Imai E,
    5. Ogihara T,
    6. Hori M
    : Snail, a transcriptional regulator, represses nephrin expression in glomerular epithelial cells of nephrotic rats. Lab Invest 87: 273–283, 2007pmid:17260001
    OpenUrlCrossRefPubMed
  45. ↵
    1. Guo L,
    2. Sanders PW,
    3. Woods A,
    4. Wu C
    : The distribution and regulation of integrin-linked kinase in normal and diabetic kidneys. Am J Pathol 159: 1735–1742, 2001pmid:11696434
    OpenUrlCrossRefPubMed
  46. ↵
    1. Teixeira VP,
    2. Blattner SM,
    3. Li M,
    4. Anders HJ,
    5. Cohen CD,
    6. Edenhofer I,
    7. Calvaresi N,
    8. Merkle M,
    9. Rastaldi MP,
    10. Kretzler M
    : Functional consequences of integrin-linked kinase activation in podocyte damage. Kidney Int 67: 514–523, 2005pmid:15673299
    OpenUrlCrossRefPubMed
  47. ↵
    1. Kos CH,
    2. Le TC,
    3. Sinha S,
    4. Henderson JM,
    5. Kim SH,
    6. Sugimoto H,
    7. Kalluri R,
    8. Gerszten RE,
    9. Pollak MR
    : Mice deficient in alpha-actinin-4 have severe glomerular disease. J Clin Invest 111: 1683–1690, 2003pmid:12782671
    OpenUrlCrossRefPubMed
  48. ↵
    1. Noris M,
    2. Mescia F,
    3. Remuzzi G
    : STEC-HUS, atypical HUS and TTP are all diseases of complement activation. Nat Rev Nephrol 8: 622–633, 2012pmid:22986360
    OpenUrlCrossRefPubMed
  49. ↵
    1. Schmidtko J,
    2. Peine S,
    3. El-Housseini Y,
    4. Pascual M,
    5. Meier P
    : Treatment of atypical hemolytic uremic syndrome and thrombotic microangiopathies: A focus on eculizumab. Am J Kidney Dis 61: 289–299, 2013pmid:23141475
    OpenUrlCrossRefPubMed
  50. ↵
    1. Matsumoto M,
    2. Fukuda W,
    3. Circolo A,
    4. Goellner J,
    5. Strauss-Schoenberger J,
    6. Wang X,
    7. Fujita S,
    8. Hidvegi T,
    9. Chaplin DD,
    10. Colten HR
    : Abrogation of the alternative complement pathway by targeted deletion of murine factor B. Proc Natl Acad Sci U S A 94: 8720–8725, 1997pmid:9238044
    OpenUrlAbstract/FREE Full Text
  51. ↵
    1. Mark Taylor C
    : Enterohaemorrhagic Escherichia coli and Shigella dysenteriae type 1-induced haemolytic uraemic syndrome. Pediatr Nephrol 23: 1425–1431, 2008pmid:18493800
    OpenUrlCrossRefPubMed
  52. ↵
    1. Rutjes NW,
    2. Binnington BA,
    3. Smith CR,
    4. Maloney MD,
    5. Lingwood CA
    : Differential tissue targeting and pathogenesis of verotoxins 1 and 2 in the mouse animal model. Kidney Int 62: 832–845, 2002pmid:12164865
    OpenUrlCrossRefPubMed
  53. ↵
    1. Benigni A,
    2. Zoja C,
    3. Tomasoni S,
    4. Campana M,
    5. Corna D,
    6. Zanchi C,
    7. Gagliardini E,
    8. Garofano E,
    9. Rottoli D,
    10. Ito T,
    11. Remuzzi G
    : Transcriptional regulation of nephrin gene by peroxisome proliferator-activated receptor-gamma agonist: molecular mechanism of the antiproteinuric effect of pioglitazone. J Am Soc Nephrol 17: 1624–1632, 2006pmid:16687628
    OpenUrlAbstract/FREE Full Text
  54. ↵
    1. Weibel ER
    : Practical methods for biological morphometry. In: Stereological Methods, London, Academic Press, 1979, pp 40–116
  55. ↵
    1. Macconi D,
    2. Bonomelli M,
    3. Benigni A,
    4. Plati T,
    5. Sangalli F,
    6. Longaretti L,
    7. Conti S,
    8. Kawachi H,
    9. Hill P,
    10. Remuzzi G,
    11. Remuzzi A
    : Pathophysiologic implications of reduced podocyte number in a rat model of progressive glomerular injury. Am J Pathol 168: 42–54, 2006pmid:16400008
    OpenUrlCrossRefPubMed
  56. ↵
    1. Saleem MA,
    2. O’Hare MJ,
    3. Reiser J,
    4. Coward RJ,
    5. Inward CD,
    6. Farren T,
    7. Xing CY,
    8. Ni L,
    9. Mathieson PW,
    10. Mundel P
    : A conditionally immortalized human podocyte cell line demonstrating nephrin and podocin expression. J Am Soc Nephrol 13: 630–638, 2002pmid:11856766
    OpenUrlAbstract/FREE Full Text
View Abstract
Back to top

In this issue

View Selected Citations (0)
Print
Download PDF
Article Alerts
Email Article
Citation Tools
Request Permissions
Shiga Toxin Promotes Podocyte Injury in Experimental Hemolytic Uremic Syndrome via Activation of the Alternative Pathway of Complement
Monica Locatelli, Simona Buelli, Anna Pezzotta, Daniela Corna, Luca Perico, Susanna Tomasoni, Daniela Rottoli, Paola Rizzo, Debora Conti, Joshua M. Thurman, Giuseppe Remuzzi, Carlamaria Zoja, Marina Morigi
JASN Aug 2014, 25 (8) 1786-1798; DOI: 10.1681/ASN.2013050450
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Jump to section

Keywords