Table 1.

Oligonucleotides used for the mobility shift experiments and the site-directed mutagenesisa

SequencePosition
aPositions are deduced from sequence data by Kim et al. (15). Mutated bases are underlined.
CTTGTTTCCCAGCCTGACTCTCCTTCCGTTCT CAAAGGGTCGGACTGAGAGGAAGGCAAGACCCAP-1 A-432/-398
TGTTTCCCAGCCTGGTTCTCCTTCCGTTCTGG AAGGGTCGGACCAAGAGGAAGGCAAGACCCAGAP-1 Amut-430/-396
GGTCGGCTCCCCTGTGTCTCATCCCCCGGATT GCCGAGGGGACACAGAGTAGGGGGCCTAATTCAP-1 B-384/-352
GGTCGGCTCCCCTGGTTCTCATCCCCCGGATT GCCGAGGGGACCAAGAGTAGGGGGCCTAATTCAP-1 Bmut-384/-352
AGCCGGGGAGCCCGCCCCCTTTCCCCCAGGG GCCCCTCGGGCGGGGGAAAGGGGGTCCCGACSpl-229/-198
AGCCGGGGAGCCTACCCCCTTTCCCCCAGGG GCCCCTCGGATGGGGGAAAGGGGGTCCCGACSplmut-229/-198