Table 3.

Oligonucleotide primers and PCR conditions used for SSCP analysis

Exon NumberSense (No. of Intron Bases between Primer and Exon) (5′ → 3′)Antisense (No. of Intron Bases between Primer and Exon) (5′ → 3′)PCR Annealing Temperature (°C)PCR Product Size (bp)
aNumber of exon bases between primer and beginning of translation.
1CGGACTCGCCCAGGCTCTGA(13)a(37)GACGCGTGGAGGAGGGATG60176
2AACAAAACCCTTTCTCTT(13)(5)AAGCAGTATTAGGGTTTGTT49113
3TGTGTGTTTCTCACCTCGT(14)(10)GATTTTCCAAGCTTGCAG54151
4TTTCTTTTTTCACTTGAATCT(2)(14)ACGATCAGGGTGGACTG5099
5CCCCCTCCTTTTTCCTATGT(6)(11)TTTCTAGCTACGGATTTTTC45102
6CCTCATTGAGACTTGTTCT(8)(6)TCATCTTCTGTGTGAAAAGT42116
7AATAATAAGAAACTTTGTATGT(7)(5)GGGAATTAGGCATGCAAA49106
8GTTGTTCATAGGTTGCTTTT(7)(11)TCAGTGACAGCATTCCAC4683
9GATGTTTGATGAACTTCTTC(9)(9)ATAGGGACCTTCTCTGAA52134
10TACTCTTATTCTTCTCTCAA(7)(10)CTGTAGCAAGGATGACT49117
11GTGATTTTCATTTGTGGATT(7)(9)AGCTGTTACATCATATGAACT4893
12AATAATTTGGTTTTGTGTT(9)(10)CCTGCTAATAAAACATAGTA44100
13ACTCCTGAGTGTTTTTGT(7)(5)TAATCATAAAATCGCAGA49126
14TTGTAACAATGTTGAACTGT(11)(10)ATGGGGACAATATAACTTTA50124
15ATAAAATTTGACATGGCTCT(11)(22)GACTAATCAAAACTGCACAT49133
16TTTCATGTTTTTGATTTGTT(10)(21)TGACATTTTTACTACCTCCA48116
17GACCCATTTCTTTTTGTTCT(9)(7)AAAATAGGCTATTAGGGAGA48110
18CACAATTTGTAAATGTCTT(10)(4)GATATTGTCTTTAATCACAC4694
19TCTGTATTTGTTTCTTTCTC(7)(10)AAATGCTTTAGGAAGAAAT52141
20TTATATCTTTCTAAGCCATT(22)(27)CCTTTGTAATAGCATTTCTA47125
21TCTCCATTGTGCAATTTTTA(92)(70)CTAAGCTGTGAGGAGGGTTT53367
22ATTGTCTTTGGTGCTGTAT(8)(16)GGCTTATCCTAATACAACAT49156
23AAGTAATGCTAGTATGCTCTC(7)(20)TGTGCTTGCAAAAACACT49162
24TAGTTAATAATTCGTTGA(7)(7)AAGATTTAAAAACATGAA44121
25ACAGATTCATTTGTGTACTA(20)(5)GAGGGTAAAGTTGCTAAATA54234
26ATTCAAACACATTCCTGT(8)(6)GGACTGGAAAGAAAACTAA51219
27ATCTTATGACCACAAATTTC(6)(5)CAGATTTGGCAGAGGATA54142
28AGATGCATATGTGTATTTGT(7)(18)CTTCTAAATATCCACAACAA44182
29CTAATCCTACAACAATGTTT(18)(8)TTCTGTGATAGCTTGAATTT47164
30ATAGTAATAACACAATTTCT(9)(11)GAGAAAAGTAATGACACT45209
31CCTGGGTATATACTTGTGCT(11)(27)ATGTCTCCTGCCCTTCTGG52191
32GGAAAGCATTTGTGGGTTA(28)(41)ACAGAGCCACCTTAAGAAGA52276
33TGCTTTGTGTTAATTTGTTT(6)(13)TCCTGCTATTTAGAAAGACA52149
34AAGGACCTGATGTTGTTACT(12)(17)TCTGATGTCCTGATTCCA52202
35TTCTTGTTAATACCTGGTTT(10)(11)TGATATTTTTCTATTTGAGA49160
36CAGGGCAATAACTACTTA(12)(8)GCTCATAACAGGACCTTA50146
37TACTCTATGTTTTCCCCCTA(7)(19)TCCACCACTAAAATGTAAAT52206
38TATGAGAATTTTAAAGGTAT(15)(13)TCCAGCTTTTAGAATTGTAA48195
39GGTGATCTTTTTTCTTCCTT(19)(20)CCCACATGAAAAGGAAAAAG50160
40GGGGTTTTGGGTTTTTTT(10)(8)ACGGATCAAAGATAATGAGCA50156
41CAATTATTAACATGCCAAGA(13)(11)TACATTAGGACAGGGAAGAA50112
42AAAGAAACTTATTAAGCCTT(11)(16)TTGTTATTTTATGCTGTTTA52253
43ATACTGACAGACTTTTCAT(8)(8)TAATAATGAGTCAAAATAAT50191
44GTTTTGCTCCCTTTATTTGA(7)(8)ATATAAAGAGCAATGCACAA51129
45GGAAACCCATTGATCTAAGT(31)(20)ACCTTTCTTCATTGACAGCA51164
46TGAGGCCATCATCTTCTTCT(17)(16)TCCTAGTGATCCAAGTCAAT50199
47CCACCTTACTTTTCATCCTAT(36)(15)ACTTCTTCGGTGAGGAAAC59190
48CTTTGAAAAAACGAGTTTAAG(42)(33)TTACAATCTGCATGTGGAA61324
49CTAGTAACGATGCTGAAAATAAC(42)(22)TCACTTGGTCCCATTGTAA54284
50TTCCCTTGTAATGGAATGAAA(60)(54)CACATTTTACCCAGCACAAT52271
51AACCCCAATGGACAGAGTGTT(26)(31)TGAATAGTTCTGCAATTGAGT63272
52CAGCAAAAATTCCCTTTTATG(39)(28)TGTTCTTTAGGATGAAAAAT47190