Table 1.

PAX2 genomic DNA PCR primer list

ExonSense PrimerAntisense PrimerProduct Length (bp)Annealing Temperature (°C)
1GTTCACTCATCCTCCCTCCCCCACCGGAGCCGGGCGCGGGTACTC17962
2CTGTGTGTGGGGTGTTGTGTTAAGGCGTCTTCCCGGGACAGCTGC24664
3TGACCGGCTTTCCCGGCGCAGAGGAAGCTGGAGTCCAGCC26262
4CGGAATAGGAGTGGCATTTGACTCTAGGTGGGATCTGGTTT18158
5TGATGCCATTTCCTCCTTCCGCCACACCTCTTCCCTCCT17560
7CGCCCCGAGTGTCCATGTGTTTACTTCTGCAAGCAGAAAGCTCCCT23458
8CGTGCATCAATAGAGAGCTGTCACAGCCCCCTTACCAGTCACAAC18059
9CCCTTCCCCTTTGTGTTTTTAGGCAGCTGCAGCATTGTC15160
11, 1stGCAGGCGTCACATCCCATGTGGAGGCCGAAGCTGT57
11, 2ndGCAGGCGTCACATCCCCCAGGTGGCATACTCACTTA14157
12TCTGACCCAGCCCATTCTTCTATGTGGAGGCCGAAGCTGT16358