Table 1.

Primer sets and probes of organic ion transporters for real-time PCR

SequencePositionAccession Numbera
a From GenBank database.
hOAT1
    forward primergcgcctttttttgccttct1030–1048AB009698
    reverse primerttcccgcttcccattgatc1161–1143
    Taqman probecatctactcctggttcttcattgagtcggc1050–1079
hOAT2
    forward primerccatccaggacgtggagaga1663–1682AF097518
    reverse primercccacttagttctggacctgctt1747–1725
    Taqman probetgccccaaccagtcttcaggaggaag1688–1713
hOAT3
    forward primercaccatcctctccttaagctacct1109–1130AF097491
    reverse primeractgtctccacggtctgcaagt1229–1208
    Taqman probecatcttggctctcacctttgtgccctt1179–1205
hOAT4
    forward primercaagcacttcaggagctcagaaa923–945AB026198
    reverse primergctggacatcagcacctctatg1009–988
    Taqman probetggccaggataaatggccacaagga948–972
hOCT1
    forward primertcttccatcgtcactgagttcaac447–470U77086
    reverse primeragaagcccgcattcaaacag531–512
    Taqman probectgactcctggaagctggacctctttca481–508
hOCT2
    forward primergatggcagcaagaccaaaagta1849–1870X98333
    reverse primeractccactggctgtagacctaggt1957–1934
    Taqman probeaaatccctgcactcatcacaaagcccatac1872–1901
hOCT3
    forward primerccctgtggtctctgacccatta352–433AF078749
    reverse primercattcttgatggagctgtcatgag493–470
    Taqman probeaaagagagacaagagaagcccccaacctga438–467
hOCTN1
    forward primercagacaggtttggcaggaaga637–657AB007448
    reverse primergcccacgatgacaaataacaca758–737
    Taqman probetacagactggcttcagcttcctgcagattt682–711
hOCTN2
    forward primerctgtgtctgacttgctcctggat2012–2034AF057164
    reverse primerttgtctgtaggtagccccagtgt2112–2090
    Taqman probeacccacactcagaggctacatatggcccta2039–2068