Table 1.

Primers derived from the hKLK1 gene sequence used for polymorphism identification and genotyping

Primers5′-Sequence-3′
a Primers used for the single-strand conformational polymorphism (SSCP) detection technique. F, forward; R, reverse.
b Primers used for allele-specific oligonucleotide (ASO) hybridization. Polymorphic alleles are indicated below.
SSCPa
    5′-F1GGTCACTGATTCCTCCGTCTTC
    5′-R1TTGCCCCCCCGCCTCCGATC
    5′-F2GCGTGATCCAGGGCCTGCAG
    5′-R2CAGGGACAGGGCGAGCGAC
    exon 1-FGTTCCCCAGTTCCTCCACCTG
    exon 1-RGGCCCGTTCCCCCTCCCAC
    exon 2-FCCTGGCCTCTCCTGCCAACC
    exon 2-RCTCCTCCCAGACCCCAGGCC
    exon 3-F1CCTTCCCGTCTTCTCATCCC
    exon 3-R1GCGTCTGTGATGGTATCAGC
    exon 3-F2GCCAAGCAGACGAGGACTAC
    exon 3-R2CCCGCCTTGGGCTACACAG
    exon 4-FCAGCCCTTTTTCTCCCGGGTTC
    exon 4-RCAGCCCTTCCAGACCCTGGG
    exon 5-FCAGAACTTGGGCCCCGTAGAC
    exon 5-RACGTGACACACATTGGATGCAC
ASOb
    C−128GGGATGGGAGGCGGGG
    G−128GGGATCGGAGGGGGGG
    C405CATCACAGACGCTGTGA
    T405TCACAGCATCTGTGATG
    C433 (Q121)TGCCCACCCAGGAACC
    G433 (E121)TGCCCACCGAGGAACC