Table 1.

Nucleotide sequences of the primers used for reverse transcription–PCR

Mouse GeneForward/ReversePrimer Sequence 5′ to 3′Product Size (bp)
Dkk1ForwardTGCTGCCCCGGGAACTACTGCAAAAATGGAATATGC430
ReverseAGTGTCTCTGGCAGGTGTGGAGCCTAGAAGAATTGC
Dkk2ForwardATGGCCGCGCTGATGCGGGTCAAGGATTCATCC777
ReverseGATCTTCTGGCATACATGGAGTCTGGCTTTGGAAGAG
Dkk3ForwardAGCCACACAGCCACAGTCTGGTGTACATGTGCAAG611
ReverseAGACAAAAGCAAAGGTTACATTTTGCCAAGTCCACG
Dkk4ForwardTGGTTCTGGACTTTAACAACATCAAGAGCTCCGC378
ReverseAGCTTTCTCCCTCCTGTCCCTTACTGCTTTGTG
sFRP1ForwardAATACCACGGAAGCCTCTAAGCCCCAAGGTACAACC872
ReverseTGATCAGACTCTTCTACCTGTAGAGGCTTAGACTCC
sFRP2ForwardACAGAGGAAGCTCCCAAGGTGTGTGAAGCCTG787
ReverseAACCTAAGTGCACGGTATAAGCCAACAGACTGACC
sFRP3ForwardACGGAGCGGATTTTCCTATGGATTCAAGTACTGG1418
ReverseAGAGTTACATACCTCTGTTAAATAACACCCTGGTGC
sFRP4ForwardAGAGGCAATAGTCACTGACCTTCCAGAAGATGTGAAG883
ReverseTGTGAATTCAGGTACCCTTCCACAAGCCTTCCCTC
sFRP5ForwardAGAGACTGCCACCTACTTGGACGACCCTAGTAG919
ReverseATGACCAGGAAGCTGCCCGTCAGGTTGTCTAACTG
ICATForwardTTGCTATTTCTTCTCAGGCGCGGTCCTCCCCTTAG409
ReverseAGAGGAGCCACACAGATCTCTTGGCCATCTGCAG
β-actinForwardTTTTCCAGCCTTCCTTCTTGGGTATGGAATCCTGTG283
ReverseATCTGCTGGAAGGTGGACAGTGAGGCCAGGATGGAG
E-cadherinForwardAAGAAGACCAGGACTTTGATTTGAGCCAGCTGC239
ReverseTTCAGAACCACTGCCCTCGTAATCGAACACCAACAG