Table 1.

Primer sets and probes for real-time PCR and RT-PCR a

Gene Name (Accession)PositionscSequences (5′ to 3′)
For real-time PCRb
    hMATE1 (AK001709)
        forward primer (+)1240 to 1262ATTGGGTACTATGTGGTTGGCCT
        reverse primer (−)1333 to 1311AGATGATGATCCCTGACCACAGA
        TaqMan probe (+)1273 to 1298ATCGCGCTGATGTTTGCAACCACACT
    hMATE2 (NM_152908)d
        forward primer (+)1444 to 1467ACTGCTGCCTTTGTTGCTTATACT
        reverse primer (−)1570 to 1551TCTCAGGCCCAGGTCTGGTT
        TaqMan probe (−)1541 to 1519TCTGCTCTCTGCTGCTGCTGCCG
For RT-PCR
    forward primer (+)ATCGTGAGCACTGTGTTCTGC
        hMATE2-K (AB250364)155 to 177
        hMATE2-B (AB250701)155 to 177
        hMATE2 (NM_152908)155 to 177
    reverse primer (−)TGGGAGATGATGTTGGCATA
        hMATE2-K (AB250364)659 to 640
        hMATE2-B (AB250701)813 to 794
        hMATE2 (NM_152908)767 to 748
    hGAPDH (NM_002046)
        forward primer (+)24 to 44CAACGGATTTGGTCGTATTGG
        reverse primer (−)836 to 816TGCTCAGTGTAGCCCAGGATG
  • a hMATE1, human multidrug and toxin extrusion 1; hMATE2-B, human brain-specific multidrug and toxin extrusion 2; hMATE2-K, human kidney-specific multidrug and toxin extrusion 2; RT-PCR, reverse transcriptase–PCR.

  • b Directions of the primer sequences are denoted in the parentheses as sense (+) or antisense (−).

  • c The nucleotides are from the sequence in the GenBank Data Bank and are numbered starting at the first residue of ATG putative initiation codon.

  • d Although only the nucleotide numbers for hMATE2 are shown, the primer and probe set also reacts with hMATE2-K and hMATE2-B.