Table 1.

Probe and primer sequences used for real-time RT-PCR analysisa

Probe/PrimerSequence
Collagen IV
    forward primer 5′-3′GGCGGTACACAGTCAGACCAT
    probeFAM-CCGCAGTGCCCTAACGGTTGGTC-MGB
    reverse primer 5′-3′GGAATAGCCGATCCACAGTGA
CTGF
    forward primer 5′-3′TGGCCCTGACCCAACTATGA
    probeFAM-ACTGCCTGGTCCAGAC-MGB
    reverse primer 5′-3′CTTAGAACAGGCGCTCCACTCT
E-cadherin
    forward primer 5′-3′AACGAGGGCATTCTGAAAACA
    probeFAM-TGCTTGGCCTCAAAATCCAAGCCCT-MGB
    reverse primer 5′-3′CACTGTCACGTGCAGAATGTACTG
Fibronectin
    forward primer 5′-3′CATGGCTTTAGGCGAACCA
    probeFAM-CCCCGTCAGGCTTA-MGB
    reverse primer 5′-3′CATCTACATTCGGCAGGTATGG
α-SMA
    forward primer 5′-3′GACCCTGAAGTATCCGATAGAACA
    probeFAM-TGCCAGATCTTTTCC-MGB
    reverse primer 5′-3′CACGCGAAGCTCGTTATAGAAG
Vimentin
    forward primer 5′-3′CCATCAACACCGAGTTCAAGAA
    probeFAM-CCGCACCAACGAGA -MGB
    reverse primer 5′-3′GGCGAAGCGGTCATTCAG
  • a CTGF, connective tissue growth factor; RT-PCR, real time reverse transcription–PCR; α -SMA, α -smooth muscle actin.