Table 1.

Primer and probe sequences for assays by designa

GeneForward Primer (5′-3′)Reverse Primer (5′-3′)Probe (5′-3′)
WNK1-TGGGATGTACCAGAAGATGTTGCTCCATGGTCTTGTGATCACCTTCACCAGACTCAACCATTTCT
WNK1-STGCTGCTGTTCTCAAAAGGATTGTATTCAGGAATTGCTACTTTGTCAAAACTGCTGGCTTCACTCCCTCATT
WNK1-LTGCATGCTTGAGATGGCTACATCTTTGTCAAAACTGGCTGGCTTCACTCCACTGGTCACTCG
WNK4GCGGAGGAGGTGGCTGCCACTGGCTGGTAGTCACCAAGGCTACCATCTCC
  • a -L, full length; -S, short; -T, total.