Table 1.

Sequences of primers and probes used for real-time reverse transcriptase–PCRa

GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Taqman Probe (5′ to 3′)
mGAPDHGGCAAATTCAACGGCACAGTAGATGGTGATGGGCTTCCCAAGGCCGAGAATGGGAAGCTTGTCATC
mCol IVGGCGGTACACAGTCAGACCATTGGTGTGCATCACGAAGGATCCGCAGTGCCCTAACGGTTGGT
mFibrGATGGAATCCGGGAGCTTTTTGCAAGGCAACCACACTGACCCGGCCTGAGGCCCTGCAG
mPDGF-AACTTCCTGATCTGGCCCCCTGAAGGCTGGCACTTGACGCAGTGCAGCGCTTCACCTCCACA
mPDGF-BCCATCCGCTCCTTTGAAGTCCAGCTCAGCCCCATCGCCTGCTGCACAGAGACTCCGTA
mPDGF-CTCGATGGCAGGTGGACTTGATACAGGAAAGCCTTGCCCAACAGCCTCTACAAGCCAACATGGCAGCT
mPDGF-DTGTGAGGTGATTGCTCTCATCTCTGTGAGGTGATTGCTCTCATCTCTTGCGCAATGCCAACCTCAGGAG
mVimGCACCCTGCAGTCATTCAGAGCAAGGATTCCACTTTCCGTTSYBR Green Kit
mTGF-β1GGACTCTCCACCTGCAAGACCGGATGGCTTCGATGCGCSYBR Green Kit
mGAPDHGGCAAATTCAACGGCACAGTAGATGGTGATGGGCTTCCCSYBR Green Kit
  • a mGAPDH, mouse glyceraldehyde-3-phosphate dehydrogenase; mCol IV, mouse type IV collagen; mFibr, mouse fibronectin; mVim, mouse vimentin; mTGF-β1, mouse TGF-β1; mPDGF-A, -B, -C, and -D, mouse PDGF-A, -B, -C, and -D.