Table 5.

Primers used for RT-PCR

GeneForward Primer (5′-3′)Reverse Primer (5′-3′)
Wt-1TGCGGCGTGTATCTGGAGTTGAAAGGTGAGTGGGAGGAA
Nphs1CCCAACACTGGAAGAGGTGTCTGGTCGTAGATTCCCCTTG
Nphs2TGAGGATGGCGGCTGAGATGGTTTGGAGGAACTTGGGT
18SAAGGGCACCACCAGGAGGGACATCTAAGGGCATCACAG
RbpsuhCGGTTTTCCTCAGTCTCCACTGCAGTAGTTCTTCCCTTCCA
GapdhCTCATGACCACAGTCCATGCCACATTGGGGGTAGGAACAC