Table 2.

Primer sequences

GenePrimerSequence(5′-3′)Product Length (bp)Temperature (°C)
OsterixForwardTCCCTTCTCAAGCACCAATGGACT23060
ReverseAGCTGTGAATGGGCTTCTTCCTCA
GAPDHForwardTGTTCCAGTATGACTCCACTCACG17060
ReverseGAAGACACCAGTAGACTCCACGACA
CBFA1ForwardTGCAAGAAGGCTCTGGCGT20060
ReverseCGCTGAAGAGGCTGTTTGACG
OCForwardTCATGTCCAAGCAGGAGGGCAATA29258
ReverseTGACATCCATACTTGCAGGGCAGA
MSX2ForwardACCACGTCCCAGCTTCTAGC18360
ReverseGCTCTGCGATGGAGAGGTACTG