Table 3.

Real-time PCR primers used

TargetForwardReverse
Glut1AACATGGAACCACCGCTACGGTGGTGAGTGTGGTGGATGG
Glut2ATCGCCCTCTGCTTCCAGTACGAACACGTAAGGCCCAAGGA
Glut12CACAGGAGGCGTGCTCATAGAGGATTATGGCGAGCCTTCTT
Rpl19TGCTCAGGCTACAGAAGAGGCTTGGGAGTTGGCATTGGCGATTTC