Table 2.

Sequences of primers for gene expression analysis

Target GeneForward 5′-3′Reverse 5′-3′
TGFβ1CAAGCAGAGTACACACAGCATTGCTCCACTTTTAACTTGAGCC
COL1A1GCCGTGACCTCAAGATGTGGCCGAACCAGACATGCCTC
CTNNB1TACCTCCCAAGTCCTGTATGAGTGAGCAGCATCAAACTGTGTAG
BMP4TGGTCTTGAGTATCCTGAGCGGCTGAGGTTAAAGAGGAAACGA
BMP6ACGGACACCACAAAGAGTTCAGCTGATGCTCCTGTAAGACTTGA
BMP7GTTCCGGTTTGATCTTTCCAATCCGGACGTCTCATTGTC
DecorinTTAGTCCTGGAGCATTTACACCTGTGCCCAGTTCTATGACAATCA
Caspase 9GCGACCTGACTGCCAAGAAATCACAATCTTCTCGACCGACA
IlkTCAAACAGCTTAACTTCCTGACGAGCACATTTGGATGCGAGAAAA
BMP1–3CGACTGCGGCTATGACTACAGTGATGGTGTCATCCGAGTG
p21CCTGTCACTGTCTTGTACCCTCAGCCGGCGTTTGGAGTGGT
GAPDHCATGAGAAGTATGACAACAGCCTAGTCCTTCCACGATACCAAAGT
  • COL1A1, collagen, type 1, alpha 1 gene; CTNNB1, β1-catenin gene; GADPH, glyceraldehyde 3-phosphate dehydrogenase gene.