Table 2.

Primers used for qRT-PCR

GeneSenseAntisense
OPNTACGACCATGAGATTGGCAGTGATATAGGATCTGGGTGCAGGCTGTAA
CD14GGGCTGCTCAAACTTTCAGAATCTAAATTGAAAGCGCTGGACCAATC
CD11cAGGTCTGCTGCTGCTGGCTAGAAGTTCTCACTGGGCAACCTG
MCP-1GCATCCACGTGTTGGCTCACTCCAGCCTACTCATTGGGATCA
TNF-αGTTCTATGGCCCAGACCCTCACGGCACCACTAGTTGGTTGTCTTTG
TGF-βGTGTGGAGCAACATGTGGAACTCTATTGGTTCAGCCACTGCCGTA
ICAM-1CAATTCACACTGAATGCCAGCTCCAAGCAGTCCGTCTCGTCCA
GAPDHTGTGTCCGTGGATCTGATTGCTGTTGAAGTCGCAGGAG