Table 6.

PCR conditions and primers used to amplify CFHR5 gene

ExonForward (5′–3′)Reverse (5′–3′)Annealing Temperature, °CFragment, bp
1CTTGCTTGCCTTTTGAAACACCCCTTCAAATTATCCTCAGC61.2585
2CTGGGCAACAAGAGTAAAACCTTCTCAAAATAGGAGGACTACATCTC61.2582
3CGGTAGCATGACCCAAATTCGGTAGGCAAACTATGTTATTGCAC61.2488
4AGTTTCCCAATTTGCCTGAGCTGCATCCTTTCTCCTTTGC61.2501
5 and 6GAGGAAACGAATGCAGTCAATCCATTCATCATGCCAGAAA57901
7TCAGTCAAAACTCCCACTAGGAACATCTTTACCAGAAAGCCAAGG57637
8GGAGATACAAGAGAGCATCTGAAAGTTTCTTCTATGAACACTGTTGGAG61.2636
9AATTATTTGAATTTCCAGACACCTTCGAATAGGCCCCATAAATAGC57568
10CATATGTAGCCCATACACAGTGCCCCCACCATCTTGGACTTCT61.2690