Table 2.

Quantitative PCR primers

NameSequenceAmpliconCode
IL-6
 ForwardTTCCATCCAGTTGCCTTCTTG101NM_031168
 ReverseTTGGGAGTGGTATCCTCTGTGA
IFN-γ
 ForwardTGCTGATGGGAGGAGATGTCT101NM_008337
 ReverseTTTCTTTCAGGGACAGCCTGTT
TNF-α
 ForwardGACGTGGAACTGGCAGAAGAG101U68415.1
 ReverseGCCACAAGCAGGAATGAGAAG
IL-4
 ForwardCACGGATGCGACAAAAATCA101NM_021283.2
 ReverseAGGACGTTTGGCACATCCAT
Myostatin
 ForwardGACAGTGTCAGCGTGTGGGTT74NM_001112698
 ReverseCCAACACCATCACCTCCTT
18S
 ForwardCCAGAGCGAAAGCATTTGCCAAGA101X00686
 ReverseTCGGCATCGTTTATGGTCGGAACT